Mutagenetix > Incidental Mutations

Incidental Mutation 'R1723:Spef2'

191633

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

039755-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.164) question?

Stock #

R1723 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9614209 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1217 (K1217R)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159288
AA Change: K1217R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: K1217R

Domain	Start	End	E-Value	Type
Pfam:CH_2	5	102	3.1e-25	PFAM
low complexity region	106	115	N/A	INTRINSIC
low complexity region	137	148	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	602	789	8.8e-11	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1221	N/A	INTRINSIC
low complexity region	1264	1278	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
SCOP:d1rec__	1378	1530	3e-3	SMART
low complexity region	1605	1624	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160236
AA Change: K1217R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: K1217R

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208854
AA Change: K1217R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.0890

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	G	T	6: 85,628,753	G2462C	probably damaging	Het
Anapc5	T	C	5: 122,799,343	E464G	probably damaging	Het
Aoc3	T	A	11: 101,336,435	V378E	possibly damaging	Het
Atp13a5	T	A	16: 29,232,799	K1152I	possibly damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC027072	A	T	17: 71,750,378	F768Y	probably damaging	Het
Calcoco1	C	A	15: 102,719,553	G49C	probably damaging	Het
Cbwd1	A	G	19: 24,948,094	V166A	possibly damaging	Het
Cd70	T	C	17: 57,146,401	T88A	possibly damaging	Het
Cpeb1	C	T	7: 81,436,226	R56Q	probably benign	Het
Dglucy	A	G	12: 100,842,679	Y212C	probably damaging	Het
Dnhd1	C	A	7: 105,714,920	P4160T	possibly damaging	Het
Ecel1	T	C	1: 87,154,421	D190G	probably benign	Het
Exoc6b	A	G	6: 85,069,344	L21P	probably damaging	Het
Fam110c	A	G	12: 31,074,395	R119G	unknown	Het
Fam198b	T	A	3: 79,936,663	N32K	probably benign	Het
Gm42791	C	A	5: 148,959,501		probably benign	Het
Hpcal4	A	G	4: 123,190,739	I154V	probably benign	Het
Itgb1	A	G	8: 128,726,038	D728G	probably damaging	Het
Kdm5d	A	T	Y: 927,753	D701V	probably damaging	Het
Kif18a	A	G	2: 109,302,882	K448E	probably damaging	Het
Kif26a	T	C	12: 112,173,858	F507S	possibly damaging	Het
Kmt2c	C	T	5: 25,315,005	G2036R	probably damaging	Het
Lrrc43	T	A	5: 123,492,213		probably benign	Het
Map3k20	T	C	2: 72,389,492	I256T	probably damaging	Het
Med29	T	A	7: 28,392,705		probably benign	Het
Mob3b	A	G	4: 34,954,026	C215R	probably damaging	Het
Mtf2	T	C	5: 108,088,070	Y87H	probably damaging	Het
Myo18a	G	A	11: 77,853,314	R1834K	probably damaging	Het
Nlrc4	T	A	17: 74,441,908	D779V	probably damaging	Het
Olfr638	T	C	7: 104,003,311	F18S	probably damaging	Het
Otud3	T	C	4: 138,898,018	T242A	probably damaging	Het
Pnliprp1	T	A	19: 58,732,142	M150K	possibly damaging	Het
Polm	T	A	11: 5,834,776	Q227L	probably benign	Het
Poln	A	G	5: 34,122,672	V282A	probably benign	Het
Ppfia2	T	A	10: 106,915,672		probably null	Het
Rad51	T	G	2: 119,123,814	M168R	probably benign	Het
Senp2	A	G	16: 22,028,042	T266A	probably benign	Het
Sfswap	A	G	5: 129,539,694	T401A	probably benign	Het
Slc35a4	C	A	18: 36,682,735	T206K	possibly damaging	Het
Slc40a1	A	G	1: 45,924,761	S23P	probably damaging	Het
St18	A	C	1: 6,810,685		probably benign	Het
Tdrd6	T	C	17: 43,628,327	D610G	possibly damaging	Het
Tmem163	C	A	1: 127,551,371	R137L	probably damaging	Het
Tmem94	T	A	11: 115,794,748	D942E	probably damaging	Het
Ttn	T	A	2: 76,750,410	I23380F	possibly damaging	Het
Uckl1	T	A	2: 181,570,600		probably null	Het
Vav2	T	C	2: 27,318,964	D99G	possibly damaging	Het
Vmn2r30	T	A	7: 7,334,260	I126F	probably benign	Het
Zbtb41	A	T	1: 139,423,563	Q138L	probably benign	Het
Zfp599	T	C	9: 22,258,065	Y37C	probably damaging	Het
Zfp784	T	A	7: 5,035,783	T259S	possibly damaging	Het
Zfp954	T	C	7: 7,115,838	S236G	probably benign	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9704536	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	synonymous	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
R7921:Spef2	UTSW	15	9609551	missense	possibly damaging	0.53
R7937:Spef2	UTSW	15	9596644	missense	possibly damaging	0.77
R7938:Spef2	UTSW	15	9687895	missense	possibly damaging	0.53
R7972:Spef2	UTSW	15	9717563	missense	probably damaging	1.00
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGATATGCAATGTGGTTTGCCAAC -3'
(R):5'- TGGACTGAAGCTCTAGTGGAATCTGAG -3'

Sequencing Primer
(F):5'- TGGTTTGCCAACTACAACCAC -3'
(R):5'- GATCATCATATTTGCTGAACGCC -3'

Posted On

2014-05-14