Incidental Mutation 'R1724:Gabpb2'
ID191658
Institutional Source Beutler Lab
Gene Symbol Gabpb2
Ensembl Gene ENSMUSG00000038766
Gene NameGA repeat binding protein, beta 2
Synonyms9430006E19Rik, Gabpb2-1, A430024B14Rik, 1810015F01Rik
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95181766-95217916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95206515 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000121283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098873] [ENSMUST00000107204] [ENSMUST00000107209] [ENSMUST00000136139]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070774
Predicted Effect probably damaging
Transcript: ENSMUST00000098873
AA Change: D19G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096470
Gene: ENSMUSG00000038766
AA Change: D19G

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-10 BLAST
ANK 37 66 3.41e-3 SMART
ANK 70 99 1.18e-6 SMART
ANK 103 132 3.76e-5 SMART
ANK 136 165 1.1e2 SMART
low complexity region 280 292 N/A INTRINSIC
coiled coil region 310 362 N/A INTRINSIC
low complexity region 363 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107204
AA Change: D19G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102822
Gene: ENSMUSG00000038766
AA Change: D19G

DomainStartEndE-ValueType
Blast:ANK 5 34 5e-11 BLAST
ANK 37 66 3.41e-3 SMART
ANK 70 99 1.18e-6 SMART
ANK 103 132 3.76e-5 SMART
ANK 136 166 1.48e3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107209
AA Change: D19G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102827
Gene: ENSMUSG00000038766
AA Change: D19G

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-10 BLAST
ANK 37 66 3.41e-3 SMART
ANK 70 99 1.18e-6 SMART
ANK 103 132 3.76e-5 SMART
ANK 136 165 1.1e2 SMART
low complexity region 280 292 N/A INTRINSIC
coiled coil region 310 362 N/A INTRINSIC
low complexity region 363 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136139
AA Change: D19G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121283
Gene: ENSMUSG00000038766
AA Change: D19G

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-10 BLAST
ANK 37 66 3.41e-3 SMART
ANK 70 99 1.18e-6 SMART
ANK 103 132 3.76e-5 SMART
ANK 136 165 1.1e2 SMART
low complexity region 280 292 N/A INTRINSIC
coiled coil region 310 362 N/A INTRINSIC
low complexity region 363 389 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155555
Meta Mutation Damage Score 0.2830 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele are viable with normal T and B cell development but show increased B cell proliferation in response to B cell receptor stimulation, and moderately increased antibody production and germinal center responses when challenged with T-dependent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Gabpb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gabpb2 APN 3 95200191 missense probably damaging 1.00
IGL02277:Gabpb2 APN 3 95189284 missense probably benign 0.02
R3980:Gabpb2 UTSW 3 95188770 missense probably damaging 0.99
R4208:Gabpb2 UTSW 3 95203934 splice site probably benign
R4656:Gabpb2 UTSW 3 95188941 missense probably damaging 1.00
R4906:Gabpb2 UTSW 3 95190636 missense probably benign 0.00
R7643:Gabpb2 UTSW 3 95200225 missense probably benign 0.09
R7848:Gabpb2 UTSW 3 95190648 missense probably damaging 0.98
R8375:Gabpb2 UTSW 3 95204798 missense probably damaging 1.00
Z1176:Gabpb2 UTSW 3 95190693 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTCTCCTACAAGGAATGACCCAG -3'
(R):5'- TCCTACAACCCAGTCATGTGCTGC -3'

Sequencing Primer
(F):5'- GGAATGACCCAGGAACCCAAG -3'
(R):5'- gttgggaagttgaggcagg -3'
Posted On2014-05-14