Incidental Mutation 'R1724:Ddah1'
ID191659
Institutional Source Beutler Lab
Gene Symbol Ddah1
Ensembl Gene ENSMUSG00000028194
Gene Namedimethylarginine dimethylaminohydrolase 1
Synonyms2410006N07Rik, 2510015N06Rik
MMRRC Submission 039756-MU
Accession Numbers

NCBI RefSeq: NM_026993.3; MGI: 1916469

Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R1724 (G1)
Quality Score203
Status Validated
Chromosome3
Chromosomal Location145758675-145894277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 145891506 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 269 (D269A)
Ref Sequence ENSEMBL: ENSMUSP00000029845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029845] [ENSMUST00000120310]
Predicted Effect probably damaging
Transcript: ENSMUST00000029845
AA Change: D269A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029845
Gene: ENSMUSG00000028194
AA Change: D269A

DomainStartEndE-ValueType
Pfam:Amidinotransf 12 279 9.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120310
AA Change: D166A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112747
Gene: ENSMUSG00000028194
AA Change: D166A

DomainStartEndE-ValueType
Pfam:Amidinotransf 1 178 2.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127193
Meta Mutation Damage Score 0.6670 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype Strain: 3711768; 5424370
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both heterozygous and homozygous inactivation of this gene leads to increased plasma asymmetrical dimethylarginine (ADMA) levels, reduced cardiovascular nitric oxide production, and increased blood pressure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(4) Gene trapped(3)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Ddah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Ddah1 APN 3 145759087 missense probably benign 0.44
P0014:Ddah1 UTSW 3 145853158 missense probably benign 0.36
R1386:Ddah1 UTSW 3 145889211 missense probably benign 0.00
R1455:Ddah1 UTSW 3 145889109 missense probably benign 0.29
R1464:Ddah1 UTSW 3 145853274 nonsense probably null
R1464:Ddah1 UTSW 3 145853274 nonsense probably null
R1557:Ddah1 UTSW 3 145891472 missense probably benign 0.00
R1853:Ddah1 UTSW 3 145891549 missense probably benign
R3700:Ddah1 UTSW 3 145891495 missense probably benign
R6170:Ddah1 UTSW 3 145891506 missense probably benign 0.06
R7603:Ddah1 UTSW 3 145759019 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGGGATGTTCAGACAGGCACACAG -3'
(R):5'- AGTTAGTAGCACAGTGGCCCAGTAG -3'

Sequencing Primer
(F):5'- CACATTGGAGACTATCCTTCATTTGG -3'
(R):5'- ACAGTGGCCCAGTAGATTGTC -3'
Posted On2014-05-14