Incidental Mutation 'R1724:Col9a2'
ID 191664
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission 039756-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1724 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120911099 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 578 (R578Q)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R578Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R578Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.1006 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,881,306 (GRCm39) V761A probably benign Het
Arap1 G T 7: 101,049,733 (GRCm39) A1032S possibly damaging Het
Atg4d C T 9: 21,179,741 (GRCm39) H230Y probably damaging Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Bcdin3d T A 15: 99,368,561 (GRCm39) K213* probably null Het
Cep295nl T A 11: 118,223,854 (GRCm39) E330V probably benign Het
Col10a1 A G 10: 34,271,714 (GRCm39) Y562C probably damaging Het
Creld1 A G 6: 113,461,535 (GRCm39) D85G possibly damaging Het
Cth A T 3: 157,619,364 (GRCm39) V153D probably damaging Het
Dazap2 T A 15: 100,515,884 (GRCm39) Y71N probably damaging Het
Ddah1 A C 3: 145,597,261 (GRCm39) D269A probably damaging Het
Dhx9 A C 1: 153,334,234 (GRCm39) D975E probably benign Het
Erich3 T A 3: 154,467,964 (GRCm39) D805E possibly damaging Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Gabpb2 T C 3: 95,113,826 (GRCm39) D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 (GRCm39) M325K probably damaging Het
Galntl5 T G 5: 25,425,120 (GRCm39) N379K possibly damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gm42791 C A 5: 148,896,311 (GRCm39) probably benign Het
Gm5356 G A 8: 89,913,684 (GRCm39) noncoding transcript Het
Kifap3 C T 1: 163,610,666 (GRCm39) R49* probably null Het
Kmt2c C T 5: 25,520,003 (GRCm39) G2036R probably damaging Het
Lce1l A T 3: 92,757,726 (GRCm39) V44E unknown Het
Lmbr1 T A 5: 29,566,081 (GRCm39) E48D probably benign Het
Nes C A 3: 87,884,748 (GRCm39) N958K probably benign Het
Nwd1 A C 8: 73,438,248 (GRCm39) H1432P probably damaging Het
Or2d2b G A 7: 106,705,409 (GRCm39) H220Y probably benign Het
Or52h9 T C 7: 104,202,435 (GRCm39) F103S probably damaging Het
Osgepl1 A G 1: 53,357,062 (GRCm39) T75A probably benign Het
Perm1 T C 4: 156,302,529 (GRCm39) S358P possibly damaging Het
Pramel14 C T 4: 143,720,002 (GRCm39) G121D probably benign Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Sdc4 G T 2: 164,273,206 (GRCm39) Q35K probably benign Het
Secisbp2 A G 13: 51,824,882 (GRCm39) S377G probably benign Het
Spag16 G C 1: 70,532,941 (GRCm39) G540A probably damaging Het
Sun1 T A 5: 139,221,480 (GRCm39) D517E probably benign Het
Taf3 A G 2: 9,957,177 (GRCm39) V177A probably benign Het
Thbs2 A G 17: 14,906,162 (GRCm39) L246P possibly damaging Het
Tle7 C A 8: 110,836,795 (GRCm39) T227N probably damaging Het
Trpm1 G T 7: 63,885,569 (GRCm39) G862* probably null Het
Trpm8 A T 1: 88,278,578 (GRCm39) T584S possibly damaging Het
Ythdc2 T C 18: 44,961,757 (GRCm39) S2P probably benign Het
Zc2hc1c G T 12: 85,336,586 (GRCm39) R81L probably benign Het
Zfp292 C A 4: 34,811,237 (GRCm39) L602F probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9120:Col9a2 UTSW 4 120,900,951 (GRCm39) splice site probably benign
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGCACTGTCTTCTCCAGTCTC -3'
(R):5'- CCCAAACTGACAAGTCTTTCTCCCG -3'

Sequencing Primer
(F):5'- AGTCTCATCTTAGACCCTTCTTCG -3'
(R):5'- ATCCAGATAAGATTTGGGAGGTTC -3'
Posted On 2014-05-14