Mutagenetix > Incidental Mutation

Incidental Mutation 'R1724:Trpm1'

191674

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, melastatin, 4732499L03Rik, LTRPC1

MMRRC Submission

039756-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1724 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63803583-63919523 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 63885569 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 862 (G862*)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

probably null
Transcript: ENSMUST00000085222
AA Change: G862*

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: G862*

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000107525
AA Change: G862*

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: G862*

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably null
Transcript: ENSMUST00000206263
AA Change: G746*

Predicted Effect

probably null
Transcript: ENSMUST00000206277
AA Change: G862*

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Meta Mutation Damage Score

0.9715

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 93.0%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts13	T	C	2: 26,881,306 (GRCm39)	V761A	probably benign	Het
Arap1	G	T	7: 101,049,733 (GRCm39)	A1032S	possibly damaging	Het
Atg4d	C	T	9: 21,179,741 (GRCm39)	H230Y	probably damaging	Het
Auh	G	A	13: 52,989,532 (GRCm39)	P308L	probably benign	Het
Bcdin3d	T	A	15: 99,368,561 (GRCm39)	K213*	probably null	Het
Cep295nl	T	A	11: 118,223,854 (GRCm39)	E330V	probably benign	Het
Col10a1	A	G	10: 34,271,714 (GRCm39)	Y562C	probably damaging	Het
Col9a2	G	A	4: 120,911,099 (GRCm39)	R578Q	probably damaging	Het
Creld1	A	G	6: 113,461,535 (GRCm39)	D85G	possibly damaging	Het
Cth	A	T	3: 157,619,364 (GRCm39)	V153D	probably damaging	Het
Dazap2	T	A	15: 100,515,884 (GRCm39)	Y71N	probably damaging	Het
Ddah1	A	C	3: 145,597,261 (GRCm39)	D269A	probably damaging	Het
Dhx9	A	C	1: 153,334,234 (GRCm39)	D975E	probably benign	Het
Erich3	T	A	3: 154,467,964 (GRCm39)	D805E	possibly damaging	Het
Fam83f	T	G	15: 80,576,468 (GRCm39)	V373G	possibly damaging	Het
Gabpb2	T	C	3: 95,113,826 (GRCm39)	D19G	probably damaging	Het
Gabrr1	T	A	4: 33,161,651 (GRCm39)	M325K	probably damaging	Het
Galntl5	T	G	5: 25,425,120 (GRCm39)	N379K	possibly damaging	Het
Gm10277	TC	T	11: 77,676,828 (GRCm39)		probably null	Het
Gm42791	C	A	5: 148,896,311 (GRCm39)		probably benign	Het
Gm5356	G	A	8: 89,913,684 (GRCm39)		noncoding transcript	Het
Kifap3	C	T	1: 163,610,666 (GRCm39)	R49*	probably null	Het
Kmt2c	C	T	5: 25,520,003 (GRCm39)	G2036R	probably damaging	Het
Lce1l	A	T	3: 92,757,726 (GRCm39)	V44E	unknown	Het
Lmbr1	T	A	5: 29,566,081 (GRCm39)	E48D	probably benign	Het
Nes	C	A	3: 87,884,748 (GRCm39)	N958K	probably benign	Het
Nwd1	A	C	8: 73,438,248 (GRCm39)	H1432P	probably damaging	Het
Or2d2b	G	A	7: 106,705,409 (GRCm39)	H220Y	probably benign	Het
Or52h9	T	C	7: 104,202,435 (GRCm39)	F103S	probably damaging	Het
Osgepl1	A	G	1: 53,357,062 (GRCm39)	T75A	probably benign	Het
Perm1	T	C	4: 156,302,529 (GRCm39)	S358P	possibly damaging	Het
Pramel14	C	T	4: 143,720,002 (GRCm39)	G121D	probably benign	Het
Ptk2	A	G	15: 73,114,255 (GRCm39)	V701A	possibly damaging	Het
Sdc4	G	T	2: 164,273,206 (GRCm39)	Q35K	probably benign	Het
Secisbp2	A	G	13: 51,824,882 (GRCm39)	S377G	probably benign	Het
Spag16	G	C	1: 70,532,941 (GRCm39)	G540A	probably damaging	Het
Sun1	T	A	5: 139,221,480 (GRCm39)	D517E	probably benign	Het
Taf3	A	G	2: 9,957,177 (GRCm39)	V177A	probably benign	Het
Thbs2	A	G	17: 14,906,162 (GRCm39)	L246P	possibly damaging	Het
Tle7	C	A	8: 110,836,795 (GRCm39)	T227N	probably damaging	Het
Trpm8	A	T	1: 88,278,578 (GRCm39)	T584S	possibly damaging	Het
Ythdc2	T	C	18: 44,961,757 (GRCm39)	S2P	probably benign	Het
Zc2hc1c	G	T	12: 85,336,586 (GRCm39)	R81L	probably benign	Het
Zfp292	C	A	4: 34,811,237 (GRCm39)	L602F	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	63,893,198 (GRCm39)	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	63,897,215 (GRCm39)	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	63,885,572 (GRCm39)	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	63,893,312 (GRCm39)	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	63,860,578 (GRCm39)	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	63,884,767 (GRCm39)	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	63,854,276 (GRCm39)	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	63,893,329 (GRCm39)	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	63,918,637 (GRCm39)	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	63,876,645 (GRCm39)	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	63,884,742 (GRCm39)	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	63,858,723 (GRCm39)	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	63,860,613 (GRCm39)	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	63,867,362 (GRCm39)	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	63,884,800 (GRCm39)	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	63,895,690 (GRCm39)	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	63,868,869 (GRCm39)	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	63,890,175 (GRCm39)	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	63,918,862 (GRCm39)	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	63,848,972 (GRCm39)	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	63,868,881 (GRCm39)	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	63,868,908 (GRCm39)	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	63,918,309 (GRCm39)	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	63,848,998 (GRCm39)	intron	probably benign
R0012:Trpm1	UTSW	7	63,918,339 (GRCm39)	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	63,897,970 (GRCm39)	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	63,893,334 (GRCm39)	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	63,894,590 (GRCm39)	unclassified	probably benign
R0463:Trpm1	UTSW	7	63,870,002 (GRCm39)	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	63,873,506 (GRCm39)	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	63,852,801 (GRCm39)	splice site	probably null
R1397:Trpm1	UTSW	7	63,867,406 (GRCm39)	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	63,873,565 (GRCm39)	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	63,890,283 (GRCm39)	missense	probably damaging	1.00
R1827:Trpm1	UTSW	7	63,884,755 (GRCm39)	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	63,876,530 (GRCm39)	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	63,880,016 (GRCm39)	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	63,917,764 (GRCm39)	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	63,873,556 (GRCm39)	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	63,879,978 (GRCm39)	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	63,858,182 (GRCm39)	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	63,858,780 (GRCm39)	intron	probably null
R2054:Trpm1	UTSW	7	63,890,303 (GRCm39)	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	63,884,736 (GRCm39)	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	63,859,724 (GRCm39)	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	63,918,849 (GRCm39)	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	63,884,760 (GRCm39)	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	63,849,061 (GRCm39)	nonsense	probably null
R3615:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	63,893,318 (GRCm39)	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	63,894,601 (GRCm39)	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	63,867,475 (GRCm39)	intron	probably benign
R3822:Trpm1	UTSW	7	63,867,451 (GRCm39)	intron	probably benign
R4441:Trpm1	UTSW	7	63,851,666 (GRCm39)	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	63,858,660 (GRCm39)	nonsense	probably null
R4666:Trpm1	UTSW	7	63,852,782 (GRCm39)	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	63,893,248 (GRCm39)	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	63,884,800 (GRCm39)	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	63,858,054 (GRCm39)	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	63,894,580 (GRCm39)	unclassified	probably benign
R5030:Trpm1	UTSW	7	63,885,579 (GRCm39)	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	63,887,441 (GRCm39)	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	63,918,702 (GRCm39)	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	63,858,694 (GRCm39)	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	63,870,018 (GRCm39)	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	63,858,159 (GRCm39)	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	63,918,710 (GRCm39)	nonsense	probably null
R5947:Trpm1	UTSW	7	63,873,547 (GRCm39)	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	63,876,553 (GRCm39)	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	63,918,450 (GRCm39)	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	63,917,724 (GRCm39)	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	63,918,226 (GRCm39)	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	63,848,942 (GRCm39)	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	63,918,252 (GRCm39)	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	63,803,781 (GRCm39)	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	63,890,343 (GRCm39)	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	63,918,045 (GRCm39)	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	63,893,181 (GRCm39)	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	63,876,462 (GRCm39)	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	63,885,593 (GRCm39)	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	63,918,445 (GRCm39)	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	63,854,333 (GRCm39)	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	63,868,854 (GRCm39)	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	63,859,729 (GRCm39)	nonsense	probably null
R7367:Trpm1	UTSW	7	63,918,549 (GRCm39)	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	63,858,723 (GRCm39)	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	63,890,330 (GRCm39)	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	63,858,657 (GRCm39)	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	63,854,303 (GRCm39)	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	63,897,939 (GRCm39)	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	63,851,689 (GRCm39)	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	63,858,718 (GRCm39)	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	63,849,017 (GRCm39)	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	63,851,699 (GRCm39)	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	63,918,777 (GRCm39)	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	63,918,541 (GRCm39)	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	63,897,155 (GRCm39)	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	63,874,356 (GRCm39)	splice site	probably null
R8813:Trpm1	UTSW	7	63,851,756 (GRCm39)	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	63,918,628 (GRCm39)	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	63,858,089 (GRCm39)	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	63,848,943 (GRCm39)	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	63,890,319 (GRCm39)	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	63,884,713 (GRCm39)	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	63,873,623 (GRCm39)	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	63,918,480 (GRCm39)	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	63,873,446 (GRCm39)	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	63,803,616 (GRCm39)	unclassified	probably benign
R9616:Trpm1	UTSW	7	63,858,132 (GRCm39)	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	63,898,041 (GRCm39)	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	63,918,658 (GRCm39)	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	63,854,342 (GRCm39)	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	63,852,879 (GRCm39)	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	63,867,439 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAGATGGCTCATTCCCACCTGC -3'
(R):5'- GGCCTCGGATAGCCAATACCCTTAC -3'

Sequencing Primer
(F):5'- TTGGAGATGGCCTAATCCCAC -3'
(R):5'- GTCCTAGTTTTGATTTTAGCTCAATG -3'

Posted On

2014-05-14