Incidental Mutation 'R1690:Pth2r'
ID191698
Institutional Source Beutler Lab
Gene Symbol Pth2r
Ensembl Gene ENSMUSG00000025946
Gene Nameparathyroid hormone 2 receptor
SynonymsPthr2
MMRRC Submission 039723-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1690 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location65282056-65389244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65372303 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 333 (T333I)
Ref Sequence ENSEMBL: ENSMUSP00000027083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027083]
Predicted Effect probably benign
Transcript: ENSMUST00000027083
AA Change: T333I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: T333I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
HormR 59 134 8.15e-28 SMART
Pfam:7tm_2 139 406 5.1e-81 PFAM
low complexity region 447 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,911,525 S263P probably damaging Het
Adcy10 A G 1: 165,519,925 E403G probably damaging Het
Adgrg7 A T 16: 56,795,630 V11E probably damaging Het
Arhgap35 A G 7: 16,563,281 C620R probably damaging Het
Cfap43 A G 19: 47,751,066 probably null Het
Cfap54 A G 10: 93,035,442 S639P possibly damaging Het
Csf2rb T C 15: 78,348,644 V717A probably benign Het
D17H6S53E A G 17: 35,127,212 D33G possibly damaging Het
Dpf2 C T 19: 5,905,462 R131Q probably damaging Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgf15 A G 7: 144,899,928 S213G probably damaging Het
Fmn1 T A 2: 113,525,482 F756Y unknown Het
Gm13089 T C 4: 143,698,123 E250G probably benign Het
Hnrnpk T A 13: 58,400,354 T13S probably benign Het
Htr3b T A 9: 48,937,094 M284L possibly damaging Het
Itgal T C 7: 127,302,117 M225T possibly damaging Het
Lipi A G 16: 75,541,125 Y454H probably damaging Het
Lrit3 T C 3: 129,800,745 K61R probably damaging Het
Lta4h A G 10: 93,484,692 D583G probably benign Het
Mettl17 T A 14: 51,891,461 V396D probably damaging Het
Nlrc4 G A 17: 74,437,523 R788* probably null Het
Olfr1061 T A 2: 86,413,954 I33F probably benign Het
Pepd G A 7: 35,031,357 G278D probably damaging Het
Prkcsh T A 9: 22,010,575 D245E probably damaging Het
Prlr A T 15: 10,317,590 D84V probably damaging Het
Ptk2 T A 15: 73,262,610 I547F probably damaging Het
Rab11fip2 A T 19: 59,937,300 S162T probably damaging Het
Rnf41 C A 10: 128,435,460 Q80K possibly damaging Het
Scn7a T G 2: 66,675,943 D1534A probably damaging Het
Sept12 A G 16: 4,988,514 V261A probably damaging Het
Sh2d4a T C 8: 68,294,449 S110P probably benign Het
Soat1 A T 1: 156,444,574 S114T probably benign Het
Taar8a A G 10: 24,076,915 Y139C probably damaging Het
Tcf12 A G 9: 71,870,072 probably null Het
Tmem202 T A 9: 59,519,108 R258S possibly damaging Het
Ttc39b A T 4: 83,227,177 I604N probably damaging Het
Vit A G 17: 78,624,865 D467G probably damaging Het
Zc3hc1 A G 6: 30,390,941 V21A probably damaging Het
Zfp608 T A 18: 54,987,634 I294F possibly damaging Het
Zfp825 T A 13: 74,480,662 H227L probably benign Het
Other mutations in Pth2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Pth2r APN 1 65388725 missense probably benign 0.08
IGL02054:Pth2r APN 1 65336781 missense probably damaging 1.00
IGL02429:Pth2r APN 1 65346839 missense probably benign 0.05
R0277:Pth2r UTSW 1 65388616 missense probably benign
R0323:Pth2r UTSW 1 65388616 missense probably benign
R0415:Pth2r UTSW 1 65388439 missense probably benign
R1067:Pth2r UTSW 1 65372348 missense possibly damaging 0.92
R1463:Pth2r UTSW 1 65363277 missense probably damaging 0.96
R1566:Pth2r UTSW 1 65388538 missense possibly damaging 0.50
R1710:Pth2r UTSW 1 65336838 missense possibly damaging 0.48
R1957:Pth2r UTSW 1 65372355 missense probably damaging 1.00
R2062:Pth2r UTSW 1 65343562 missense probably damaging 1.00
R2232:Pth2r UTSW 1 65336769 missense probably damaging 1.00
R2942:Pth2r UTSW 1 65388476 missense probably benign 0.00
R3011:Pth2r UTSW 1 65336988 missense probably benign 0.05
R3857:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3858:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R3859:Pth2r UTSW 1 65322047 missense probably damaging 0.98
R4540:Pth2r UTSW 1 65282201 missense probably benign
R4694:Pth2r UTSW 1 65336761 missense probably benign
R4777:Pth2r UTSW 1 65388517 missense possibly damaging 0.90
R4926:Pth2r UTSW 1 65321984 missense probably benign 0.27
R5209:Pth2r UTSW 1 65388697 missense probably benign 0.04
R5871:Pth2r UTSW 1 65388637 missense probably damaging 1.00
R6868:Pth2r UTSW 1 65388479 missense probably benign 0.02
R7132:Pth2r UTSW 1 65322066 missense probably benign 0.00
R7242:Pth2r UTSW 1 65388620 missense probably benign 0.42
R7677:Pth2r UTSW 1 65388446 missense probably benign 0.00
R7836:Pth2r UTSW 1 65351563 missense probably damaging 1.00
R7919:Pth2r UTSW 1 65351563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAGGCAGAGCGAGGTTTTAATAT -3'
(R):5'- AGCTATCAATTCACCAAAGATTGGGTGT -3'

Sequencing Primer
(F):5'- GCCTTCCATAAGGCTATATCTGAAC -3'
(R):5'- ACTTGCTTCCAACAAATCGTG -3'
Posted On2014-05-14