Incidental Mutation 'R1690:Arhgap35'
ID191711
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission 039723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1690 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16563281 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 620 (C620R)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably damaging
Transcript: ENSMUST00000075845
AA Change: C620R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: C620R

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171937
AA Change: C620R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: C620R

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,911,525 S263P probably damaging Het
Adcy10 A G 1: 165,519,925 E403G probably damaging Het
Adgrg7 A T 16: 56,795,630 V11E probably damaging Het
Cfap43 A G 19: 47,751,066 probably null Het
Cfap54 A G 10: 93,035,442 S639P possibly damaging Het
Csf2rb T C 15: 78,348,644 V717A probably benign Het
D17H6S53E A G 17: 35,127,212 D33G possibly damaging Het
Dpf2 C T 19: 5,905,462 R131Q probably damaging Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgf15 A G 7: 144,899,928 S213G probably damaging Het
Fmn1 T A 2: 113,525,482 F756Y unknown Het
Gm13089 T C 4: 143,698,123 E250G probably benign Het
Hnrnpk T A 13: 58,400,354 T13S probably benign Het
Htr3b T A 9: 48,937,094 M284L possibly damaging Het
Itgal T C 7: 127,302,117 M225T possibly damaging Het
Lipi A G 16: 75,541,125 Y454H probably damaging Het
Lrit3 T C 3: 129,800,745 K61R probably damaging Het
Lta4h A G 10: 93,484,692 D583G probably benign Het
Mettl17 T A 14: 51,891,461 V396D probably damaging Het
Nlrc4 G A 17: 74,437,523 R788* probably null Het
Olfr1061 T A 2: 86,413,954 I33F probably benign Het
Pepd G A 7: 35,031,357 G278D probably damaging Het
Prkcsh T A 9: 22,010,575 D245E probably damaging Het
Prlr A T 15: 10,317,590 D84V probably damaging Het
Pth2r C T 1: 65,372,303 T333I probably benign Het
Ptk2 T A 15: 73,262,610 I547F probably damaging Het
Rab11fip2 A T 19: 59,937,300 S162T probably damaging Het
Rnf41 C A 10: 128,435,460 Q80K possibly damaging Het
Scn7a T G 2: 66,675,943 D1534A probably damaging Het
Sept12 A G 16: 4,988,514 V261A probably damaging Het
Sh2d4a T C 8: 68,294,449 S110P probably benign Het
Soat1 A T 1: 156,444,574 S114T probably benign Het
Taar8a A G 10: 24,076,915 Y139C probably damaging Het
Tcf12 A G 9: 71,870,072 probably null Het
Tmem202 T A 9: 59,519,108 R258S possibly damaging Het
Ttc39b A T 4: 83,227,177 I604N probably damaging Het
Vit A G 17: 78,624,865 D467G probably damaging Het
Zc3hc1 A G 6: 30,390,941 V21A probably damaging Het
Zfp608 T A 18: 54,987,634 I294F possibly damaging Het
Zfp825 T A 13: 74,480,662 H227L probably benign Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTCCACCACATAGGACAGTGACTC -3'
(R):5'- AGCGTGATGCCCTCATTCTGAAG -3'

Sequencing Primer
(F):5'- CACATAGGACAGTGACTCCTTTG -3'
(R):5'- TTTGTGTACCACCCGACGAAG -3'
Posted On2014-05-14