Incidental Mutation 'R1690:Fgf15'
ID191716
Institutional Source Beutler Lab
Gene Symbol Fgf15
Ensembl Gene ENSMUSG00000031073
Gene Namefibroblast growth factor 15
SynonymsFGF19
MMRRC Submission 039723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1690 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location144896531-144900953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144899928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 213 (S213G)
Ref Sequence ENSEMBL: ENSMUSP00000033389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033389] [ENSMUST00000207229]
Predicted Effect probably damaging
Transcript: ENSMUST00000033389
AA Change: S213G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033389
Gene: ENSMUSG00000031073
AA Change: S213G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 49 177 1.93e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207040
Predicted Effect probably benign
Transcript: ENSMUST00000207229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208515
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to a severe underrepresentation of homozygotes at weaning as well as highly penetrant ventricular septal defects and malalignment of the aorta and pulmonary trunk. No abnormalities in otic induction or otic vesicle formation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,911,525 S263P probably damaging Het
Adcy10 A G 1: 165,519,925 E403G probably damaging Het
Adgrg7 A T 16: 56,795,630 V11E probably damaging Het
Arhgap35 A G 7: 16,563,281 C620R probably damaging Het
Cfap43 A G 19: 47,751,066 probably null Het
Cfap54 A G 10: 93,035,442 S639P possibly damaging Het
Csf2rb T C 15: 78,348,644 V717A probably benign Het
D17H6S53E A G 17: 35,127,212 D33G possibly damaging Het
Dpf2 C T 19: 5,905,462 R131Q probably damaging Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fmn1 T A 2: 113,525,482 F756Y unknown Het
Gm13089 T C 4: 143,698,123 E250G probably benign Het
Hnrnpk T A 13: 58,400,354 T13S probably benign Het
Htr3b T A 9: 48,937,094 M284L possibly damaging Het
Itgal T C 7: 127,302,117 M225T possibly damaging Het
Lipi A G 16: 75,541,125 Y454H probably damaging Het
Lrit3 T C 3: 129,800,745 K61R probably damaging Het
Lta4h A G 10: 93,484,692 D583G probably benign Het
Mettl17 T A 14: 51,891,461 V396D probably damaging Het
Nlrc4 G A 17: 74,437,523 R788* probably null Het
Olfr1061 T A 2: 86,413,954 I33F probably benign Het
Pepd G A 7: 35,031,357 G278D probably damaging Het
Prkcsh T A 9: 22,010,575 D245E probably damaging Het
Prlr A T 15: 10,317,590 D84V probably damaging Het
Pth2r C T 1: 65,372,303 T333I probably benign Het
Ptk2 T A 15: 73,262,610 I547F probably damaging Het
Rab11fip2 A T 19: 59,937,300 S162T probably damaging Het
Rnf41 C A 10: 128,435,460 Q80K possibly damaging Het
Scn7a T G 2: 66,675,943 D1534A probably damaging Het
Sept12 A G 16: 4,988,514 V261A probably damaging Het
Sh2d4a T C 8: 68,294,449 S110P probably benign Het
Soat1 A T 1: 156,444,574 S114T probably benign Het
Taar8a A G 10: 24,076,915 Y139C probably damaging Het
Tcf12 A G 9: 71,870,072 probably null Het
Tmem202 T A 9: 59,519,108 R258S possibly damaging Het
Ttc39b A T 4: 83,227,177 I604N probably damaging Het
Vit A G 17: 78,624,865 D467G probably damaging Het
Zc3hc1 A G 6: 30,390,941 V21A probably damaging Het
Zfp608 T A 18: 54,987,634 I294F possibly damaging Het
Zfp825 T A 13: 74,480,662 H227L probably benign Het
Other mutations in Fgf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Fgf15 APN 7 144899892 missense probably damaging 1.00
IGL00764:Fgf15 APN 7 144896935 splice site probably null
R2444:Fgf15 UTSW 7 144899692 missense probably benign 0.03
R5073:Fgf15 UTSW 7 144896839 missense possibly damaging 0.94
R6149:Fgf15 UTSW 7 144899769 nonsense probably null
R7287:Fgf15 UTSW 7 144896794 missense probably benign 0.27
R7396:Fgf15 UTSW 7 144899805 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGCTCATGCACACAGCCTCTTG -3'
(R):5'- ATCAGCAGCCTCCAAAGTCAGTG -3'

Sequencing Primer
(F):5'- TGGACTGTTTAGGCTACAACCAG -3'
(R):5'- AACAGGGTCCATGTGAGACT -3'
Posted On2014-05-14