Incidental Mutation 'R1690:Tmem202'
ID191720
Institutional Source Beutler Lab
Gene Symbol Tmem202
Ensembl Gene ENSMUSG00000049526
Gene Nametransmembrane protein 202
Synonyms4930425N13Rik
MMRRC Submission 039723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1690 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59518685-59539847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59519108 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 258 (R258S)
Ref Sequence ENSEMBL: ENSMUSP00000053782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055345]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055345
AA Change: R258S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053782
Gene: ENSMUSG00000049526
AA Change: R258S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 50 206 2.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214580
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,911,525 S263P probably damaging Het
Adcy10 A G 1: 165,519,925 E403G probably damaging Het
Adgrg7 A T 16: 56,795,630 V11E probably damaging Het
Arhgap35 A G 7: 16,563,281 C620R probably damaging Het
Cfap43 A G 19: 47,751,066 probably null Het
Cfap54 A G 10: 93,035,442 S639P possibly damaging Het
Csf2rb T C 15: 78,348,644 V717A probably benign Het
D17H6S53E A G 17: 35,127,212 D33G possibly damaging Het
Dpf2 C T 19: 5,905,462 R131Q probably damaging Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgf15 A G 7: 144,899,928 S213G probably damaging Het
Fmn1 T A 2: 113,525,482 F756Y unknown Het
Gm13089 T C 4: 143,698,123 E250G probably benign Het
Hnrnpk T A 13: 58,400,354 T13S probably benign Het
Htr3b T A 9: 48,937,094 M284L possibly damaging Het
Itgal T C 7: 127,302,117 M225T possibly damaging Het
Lipi A G 16: 75,541,125 Y454H probably damaging Het
Lrit3 T C 3: 129,800,745 K61R probably damaging Het
Lta4h A G 10: 93,484,692 D583G probably benign Het
Mettl17 T A 14: 51,891,461 V396D probably damaging Het
Nlrc4 G A 17: 74,437,523 R788* probably null Het
Olfr1061 T A 2: 86,413,954 I33F probably benign Het
Pepd G A 7: 35,031,357 G278D probably damaging Het
Prkcsh T A 9: 22,010,575 D245E probably damaging Het
Prlr A T 15: 10,317,590 D84V probably damaging Het
Pth2r C T 1: 65,372,303 T333I probably benign Het
Ptk2 T A 15: 73,262,610 I547F probably damaging Het
Rab11fip2 A T 19: 59,937,300 S162T probably damaging Het
Rnf41 C A 10: 128,435,460 Q80K possibly damaging Het
Scn7a T G 2: 66,675,943 D1534A probably damaging Het
Sept12 A G 16: 4,988,514 V261A probably damaging Het
Sh2d4a T C 8: 68,294,449 S110P probably benign Het
Soat1 A T 1: 156,444,574 S114T probably benign Het
Taar8a A G 10: 24,076,915 Y139C probably damaging Het
Tcf12 A G 9: 71,870,072 probably null Het
Ttc39b A T 4: 83,227,177 I604N probably damaging Het
Vit A G 17: 78,624,865 D467G probably damaging Het
Zc3hc1 A G 6: 30,390,941 V21A probably damaging Het
Zfp608 T A 18: 54,987,634 I294F possibly damaging Het
Zfp825 T A 13: 74,480,662 H227L probably benign Het
Other mutations in Tmem202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Tmem202 APN 9 59519068 missense possibly damaging 0.53
R0011:Tmem202 UTSW 9 59524801 missense probably benign 0.00
R0011:Tmem202 UTSW 9 59524801 missense probably benign 0.00
R0711:Tmem202 UTSW 9 59525372 missense probably damaging 0.99
R2127:Tmem202 UTSW 9 59520200 missense probably benign 0.41
R4747:Tmem202 UTSW 9 59519194 missense possibly damaging 0.47
R4998:Tmem202 UTSW 9 59524846 missense probably damaging 0.99
R6916:Tmem202 UTSW 9 59525474 start gained probably benign
R6929:Tmem202 UTSW 9 59519221 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCACTCCAGAAGAGAACGCTGAC -3'
(R):5'- GTGTGGTGGGAAAGCATAGATTTGGTAA -3'

Sequencing Primer
(F):5'- agccgtttctccagccc -3'
(R):5'- aaagcatagatttggtaatcaaaagc -3'
Posted On2014-05-14