Incidental Mutation 'R1690:Vit'
ID191744
Institutional Source Beutler Lab
Gene Symbol Vit
Ensembl Gene ENSMUSG00000024076
Gene Namevitrin
Synonyms
MMRRC Submission 039723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1690 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78508063-78627409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78624865 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 467 (D467G)
Ref Sequence ENSEMBL: ENSMUSP00000024880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024880]
Predicted Effect probably damaging
Transcript: ENSMUST00000024880
AA Change: D467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024880
Gene: ENSMUSG00000024076
AA Change: D467G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 42 124 2.5e-45 SMART
low complexity region 148 171 N/A INTRINSIC
VWA 263 451 7.34e-39 SMART
VWA 465 641 1.02e-46 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele show decreased spinal cord size associated with reduced cell proliferation and altered cell differentiation in the central canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,911,525 S263P probably damaging Het
Adcy10 A G 1: 165,519,925 E403G probably damaging Het
Adgrg7 A T 16: 56,795,630 V11E probably damaging Het
Arhgap35 A G 7: 16,563,281 C620R probably damaging Het
Cfap43 A G 19: 47,751,066 probably null Het
Cfap54 A G 10: 93,035,442 S639P possibly damaging Het
Csf2rb T C 15: 78,348,644 V717A probably benign Het
D17H6S53E A G 17: 35,127,212 D33G possibly damaging Het
Dpf2 C T 19: 5,905,462 R131Q probably damaging Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgf15 A G 7: 144,899,928 S213G probably damaging Het
Fmn1 T A 2: 113,525,482 F756Y unknown Het
Gm13089 T C 4: 143,698,123 E250G probably benign Het
Hnrnpk T A 13: 58,400,354 T13S probably benign Het
Htr3b T A 9: 48,937,094 M284L possibly damaging Het
Itgal T C 7: 127,302,117 M225T possibly damaging Het
Lipi A G 16: 75,541,125 Y454H probably damaging Het
Lrit3 T C 3: 129,800,745 K61R probably damaging Het
Lta4h A G 10: 93,484,692 D583G probably benign Het
Mettl17 T A 14: 51,891,461 V396D probably damaging Het
Nlrc4 G A 17: 74,437,523 R788* probably null Het
Olfr1061 T A 2: 86,413,954 I33F probably benign Het
Pepd G A 7: 35,031,357 G278D probably damaging Het
Prkcsh T A 9: 22,010,575 D245E probably damaging Het
Prlr A T 15: 10,317,590 D84V probably damaging Het
Pth2r C T 1: 65,372,303 T333I probably benign Het
Ptk2 T A 15: 73,262,610 I547F probably damaging Het
Rab11fip2 A T 19: 59,937,300 S162T probably damaging Het
Rnf41 C A 10: 128,435,460 Q80K possibly damaging Het
Scn7a T G 2: 66,675,943 D1534A probably damaging Het
Sept12 A G 16: 4,988,514 V261A probably damaging Het
Sh2d4a T C 8: 68,294,449 S110P probably benign Het
Soat1 A T 1: 156,444,574 S114T probably benign Het
Taar8a A G 10: 24,076,915 Y139C probably damaging Het
Tcf12 A G 9: 71,870,072 probably null Het
Tmem202 T A 9: 59,519,108 R258S possibly damaging Het
Ttc39b A T 4: 83,227,177 I604N probably damaging Het
Zc3hc1 A G 6: 30,390,941 V21A probably damaging Het
Zfp608 T A 18: 54,987,634 I294F possibly damaging Het
Zfp825 T A 13: 74,480,662 H227L probably benign Het
Other mutations in Vit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vit APN 17 78601907 critical splice donor site probably null
IGL00929:Vit APN 17 78579401 missense probably damaging 0.98
IGL01447:Vit APN 17 78625204 missense probably damaging 1.00
IGL02000:Vit APN 17 78605486 missense possibly damaging 0.94
IGL02230:Vit APN 17 78619627 missense probably damaging 1.00
IGL02245:Vit APN 17 78625051 missense probably damaging 1.00
IGL02315:Vit APN 17 78622658 missense possibly damaging 0.80
IGL03133:Vit APN 17 78566071 missense probably benign
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0520:Vit UTSW 17 78625159 missense probably damaging 1.00
R0550:Vit UTSW 17 78624793 missense possibly damaging 0.95
R0565:Vit UTSW 17 78624837 missense probably damaging 1.00
R0856:Vit UTSW 17 78619657 missense possibly damaging 0.53
R1155:Vit UTSW 17 78566027 missense probably damaging 1.00
R1327:Vit UTSW 17 78625200 missense probably damaging 1.00
R1802:Vit UTSW 17 78605511 missense possibly damaging 0.91
R1822:Vit UTSW 17 78622836 missense probably benign 0.01
R1826:Vit UTSW 17 78534676 missense probably benign 0.22
R1827:Vit UTSW 17 78546446 critical splice donor site probably null
R1862:Vit UTSW 17 78622746 missense probably damaging 1.00
R2235:Vit UTSW 17 78605438 missense probably benign 0.01
R2571:Vit UTSW 17 78586745 missense probably benign
R4011:Vit UTSW 17 78534692 splice site probably benign
R4190:Vit UTSW 17 78586826 missense probably benign 0.13
R4191:Vit UTSW 17 78586826 missense probably benign 0.13
R4192:Vit UTSW 17 78586826 missense probably benign 0.13
R4193:Vit UTSW 17 78586826 missense probably benign 0.13
R4635:Vit UTSW 17 78574212 missense probably benign 0.01
R4705:Vit UTSW 17 78625114 missense probably damaging 1.00
R4841:Vit UTSW 17 78601879 missense probably benign
R4842:Vit UTSW 17 78601879 missense probably benign
R4884:Vit UTSW 17 78624753 missense probably damaging 0.99
R4923:Vit UTSW 17 78586841 missense probably benign 0.03
R5128:Vit UTSW 17 78625146 missense probably damaging 1.00
R5272:Vit UTSW 17 78586835 missense probably benign
R5779:Vit UTSW 17 78546426 missense probably benign
R6596:Vit UTSW 17 78622845 missense probably benign 0.35
R6658:Vit UTSW 17 78622803 missense possibly damaging 0.93
R6792:Vit UTSW 17 78579399 missense probably damaging 1.00
R6894:Vit UTSW 17 78626758 nonsense probably null
R7032:Vit UTSW 17 78624865 missense probably damaging 1.00
R7061:Vit UTSW 17 78625156 missense probably damaging 1.00
R7102:Vit UTSW 17 78624997 missense probably damaging 1.00
R7106:Vit UTSW 17 78586799 missense probably benign
R7292:Vit UTSW 17 78605498 missense probably benign 0.03
R7413:Vit UTSW 17 78624880 missense probably damaging 1.00
X0023:Vit UTSW 17 78566164 missense probably benign
X0064:Vit UTSW 17 78624885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTTTCCACTGAGACAGGGACC -3'
(R):5'- TGTCGAACCCAAATTCGAGCCG -3'

Sequencing Primer
(F):5'- CTACTCTGAAGTCTACTACAGGAAGG -3'
(R):5'- CGCTGCTCGTAGGTGTACTG -3'
Posted On2014-05-14