Incidental Mutation 'R1691:Kmt2e'
ID191770
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission 039724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1691 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23464849 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 111 (D111E)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: D111E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: D111E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: D111E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: D111E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000196889
AA Change: D111E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: D111E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,499,606 S283P probably damaging Het
Adck2 T A 6: 39,574,968 L223* probably null Het
Ank T C 15: 27,590,944 W390R probably damaging Het
Ano5 T C 7: 51,590,579 Y752H probably damaging Het
Apcs T A 1: 172,894,593 D62V probably damaging Het
Atad5 A G 11: 80,095,532 T482A probably benign Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Ccdc13 A T 9: 121,825,068 probably null Het
Ccdc157 G A 11: 4,149,030 P159S probably benign Het
Cdhr3 C T 12: 33,082,247 V126M probably damaging Het
Cdr1 T C X: 61,184,174 D462G possibly damaging Het
Cisd1 A G 10: 71,344,729 V9A probably benign Het
Col19a1 T C 1: 24,536,941 R107G unknown Het
Col1a2 C A 6: 4,536,038 H972Q unknown Het
Col3a1 T A 1: 45,348,616 probably benign Het
Dbnl A G 11: 5,797,174 S235G probably null Het
Dock4 T A 12: 40,725,755 S566T probably benign Het
Efcab6 T C 15: 83,933,206 D722G probably benign Het
Esyt1 T C 10: 128,525,534 Q97R probably benign Het
Fam196a C T 7: 134,918,286 A172T probably damaging Het
Fat2 G A 11: 55,311,852 T132I probably damaging Het
Fgd2 C T 17: 29,378,944 Q618* probably null Het
Flnc T A 6: 29,441,214 V389E probably benign Het
Garnl3 A T 2: 32,997,663 Y778* probably null Het
Gpaa1 A T 15: 76,332,216 Y45F probably damaging Het
Grid1 A T 14: 35,452,329 I643F probably damaging Het
Gsdmc2 T C 15: 63,833,465 D133G probably damaging Het
Hp T C 8: 109,575,572 D248G probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna13 T C 4: 88,644,054 D111G probably benign Het
Il9r T A 11: 32,191,829 Q309L possibly damaging Het
Ints1 A T 5: 139,768,932 D617E probably damaging Het
Kcnj12 A T 11: 61,070,277 N467I possibly damaging Het
Lama4 A G 10: 39,080,563 K1161E probably benign Het
Lamc1 C T 1: 153,247,249 D732N probably benign Het
Larp1 A G 11: 58,048,048 T517A probably benign Het
Lrp12 A G 15: 39,872,265 I757T probably damaging Het
Max T C 12: 76,953,272 D23G possibly damaging Het
Nars A T 18: 64,516,414 probably null Het
Nipsnap3a G A 4: 52,994,185 D91N probably null Het
Nphp3 A G 9: 104,002,811 T11A probably benign Het
Nr2c2 C A 6: 92,156,692 T226K probably damaging Het
Nrxn1 A G 17: 90,162,289 I1288T probably damaging Het
Nt5c1b C T 12: 10,375,537 T360I possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1281 G A 2: 111,328,853 V145I probably benign Het
Olfr1505 C T 19: 13,919,419 T133I probably benign Het
Olfr1508 A T 14: 52,463,831 H59Q possibly damaging Het
Olfr214 A G 6: 116,556,577 T51A probably benign Het
Olfr516 A G 7: 108,845,141 Y290H possibly damaging Het
Olfr532 A T 7: 140,418,942 L277Q probably damaging Het
Pcsk1 A G 13: 75,132,225 D723G possibly damaging Het
Phrf1 C A 7: 141,261,874 Y715* probably null Het
Pigm T C 1: 172,376,787 V30A probably benign Het
Pkd1l2 A T 8: 117,056,419 F721I possibly damaging Het
Pla2g15 A G 8: 106,154,949 D70G possibly damaging Het
Prl7d1 A T 13: 27,709,382 I182N probably damaging Het
Prss23 T C 7: 89,510,714 K49R probably benign Het
Rps6 A T 4: 86,856,809 D19E probably benign Het
Slco6d1 A T 1: 98,507,567 H669L probably benign Het
Svil G T 18: 5,056,336 C490F probably benign Het
Tom1 T C 8: 75,051,599 I103T probably damaging Het
Trim10 T A 17: 36,876,899 Y336N probably damaging Het
Trim43c G T 9: 88,840,699 V133F probably damaging Het
Tvp23a A G 16: 10,428,687 L78P possibly damaging Het
Ugt2b38 T A 5: 87,424,132 I14L probably benign Het
Unc5a A C 13: 55,002,924 M520L probably damaging Het
Vmn1r174 T A 7: 23,753,912 M1K probably null Het
Vmn2r58 C T 7: 41,837,489 G661R possibly damaging Het
Vps41 A C 13: 18,841,243 D471A probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp462 T A 4: 55,013,489 F1818L possibly damaging Het
Zp3 G A 5: 135,980,281 E50K possibly damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTGAAACTGTGAACACAGGACTGGTAA -3'
(R):5'- GCATCTGATAGAGGCAGACATCCTACT -3'

Sequencing Primer
(F):5'- CACAGGACTGGTAATGTAGTTTCC -3'
(R):5'- gaggcagaggcaggtgg -3'
Posted On2014-05-14