Mutagenetix > Incidental Mutation

Incidental Mutation 'R1691:Zp3'

191773

Institutional Source

Beutler Lab

Gene Symbol

Zp3

Ensembl Gene

ENSMUSG00000004948

Gene Name

zona pellucida glycoprotein 3

Synonyms

Zp-3

MMRRC Submission

039724-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R1691 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135980099-135988624 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135980281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 50 (E50K)

Ref Sequence

ENSEMBL: ENSMUSP00000005073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005073]

AlphaFold

P10761

PDB Structure

ZP-N domain of mammalian sperm receptor ZP3 (crystal form I) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form II) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form III) [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005073
AA Change: E50K

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005073
Gene: ENSMUSG00000004948
AA Change: E50K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
ZP	45	304	1.22e-68	SMART
low complexity region	320	334	N/A	INTRINSIC
transmembrane domain	387	409	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000131563
AA Change: E38K

SMART Domains

Protein: ENSMUSP00000120447
Gene: ENSMUSG00000004948
AA Change: E38K

Domain	Start	End	E-Value	Type
Pfam:Zona_pellucida	35	136	6.4e-16	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous female mutants are infertile. In these females oocytes lack a zona pellucida and cumulus-oocyte complexes are disrupted. Oocytes of heterozygous females have a thin zona, but females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	T	C	7: 82,499,606	S283P	probably damaging	Het
Adck2	T	A	6: 39,574,968	L223*	probably null	Het
Ank	T	C	15: 27,590,944	W390R	probably damaging	Het
Ano5	T	C	7: 51,590,579	Y752H	probably damaging	Het
Apcs	T	A	1: 172,894,593	D62V	probably damaging	Het
Atad5	A	G	11: 80,095,532	T482A	probably benign	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Ccdc13	A	T	9: 121,825,068		probably null	Het
Ccdc157	G	A	11: 4,149,030	P159S	probably benign	Het
Cdhr3	C	T	12: 33,082,247	V126M	probably damaging	Het
Cdr1	T	C	X: 61,184,174	D462G	possibly damaging	Het
Cisd1	A	G	10: 71,344,729	V9A	probably benign	Het
Col19a1	T	C	1: 24,536,941	R107G	unknown	Het
Col1a2	C	A	6: 4,536,038	H972Q	unknown	Het
Col3a1	T	A	1: 45,348,616		probably benign	Het
Dbnl	A	G	11: 5,797,174	S235G	probably null	Het
Dock4	T	A	12: 40,725,755	S566T	probably benign	Het
Efcab6	T	C	15: 83,933,206	D722G	probably benign	Het
Esyt1	T	C	10: 128,525,534	Q97R	probably benign	Het
Fam196a	C	T	7: 134,918,286	A172T	probably damaging	Het
Fat2	G	A	11: 55,311,852	T132I	probably damaging	Het
Fgd2	C	T	17: 29,378,944	Q618*	probably null	Het
Flnc	T	A	6: 29,441,214	V389E	probably benign	Het
Garnl3	A	T	2: 32,997,663	Y778*	probably null	Het
Gpaa1	A	T	15: 76,332,216	Y45F	probably damaging	Het
Grid1	A	T	14: 35,452,329	I643F	probably damaging	Het
Gsdmc2	T	C	15: 63,833,465	D133G	probably damaging	Het
Hp	T	C	8: 109,575,572	D248G	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifna13	T	C	4: 88,644,054	D111G	probably benign	Het
Il9r	T	A	11: 32,191,829	Q309L	possibly damaging	Het
Ints1	A	T	5: 139,768,932	D617E	probably damaging	Het
Kcnj12	A	T	11: 61,070,277	N467I	possibly damaging	Het
Kmt2e	T	A	5: 23,464,849	D111E	probably damaging	Het
Lama4	A	G	10: 39,080,563	K1161E	probably benign	Het
Lamc1	C	T	1: 153,247,249	D732N	probably benign	Het
Larp1	A	G	11: 58,048,048	T517A	probably benign	Het
Lrp12	A	G	15: 39,872,265	I757T	probably damaging	Het
Max	T	C	12: 76,953,272	D23G	possibly damaging	Het
Nars	A	T	18: 64,516,414		probably null	Het
Nipsnap3a	G	A	4: 52,994,185	D91N	probably null	Het
Nphp3	A	G	9: 104,002,811	T11A	probably benign	Het
Nr2c2	C	A	6: 92,156,692	T226K	probably damaging	Het
Nrxn1	A	G	17: 90,162,289	I1288T	probably damaging	Het
Nt5c1b	C	T	12: 10,375,537	T360I	possibly damaging	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1281	G	A	2: 111,328,853	V145I	probably benign	Het
Olfr1505	C	T	19: 13,919,419	T133I	probably benign	Het
Olfr1508	A	T	14: 52,463,831	H59Q	possibly damaging	Het
Olfr214	A	G	6: 116,556,577	T51A	probably benign	Het
Olfr516	A	G	7: 108,845,141	Y290H	possibly damaging	Het
Olfr532	A	T	7: 140,418,942	L277Q	probably damaging	Het
Pcsk1	A	G	13: 75,132,225	D723G	possibly damaging	Het
Phrf1	C	A	7: 141,261,874	Y715*	probably null	Het
Pigm	T	C	1: 172,376,787	V30A	probably benign	Het
Pkd1l2	A	T	8: 117,056,419	F721I	possibly damaging	Het
Pla2g15	A	G	8: 106,154,949	D70G	possibly damaging	Het
Prl7d1	A	T	13: 27,709,382	I182N	probably damaging	Het
Prss23	T	C	7: 89,510,714	K49R	probably benign	Het
Rps6	A	T	4: 86,856,809	D19E	probably benign	Het
Slco6d1	A	T	1: 98,507,567	H669L	probably benign	Het
Svil	G	T	18: 5,056,336	C490F	probably benign	Het
Tom1	T	C	8: 75,051,599	I103T	probably damaging	Het
Trim10	T	A	17: 36,876,899	Y336N	probably damaging	Het
Trim43c	G	T	9: 88,840,699	V133F	probably damaging	Het
Tvp23a	A	G	16: 10,428,687	L78P	possibly damaging	Het
Ugt2b38	T	A	5: 87,424,132	I14L	probably benign	Het
Unc5a	A	C	13: 55,002,924	M520L	probably damaging	Het
Vmn1r174	T	A	7: 23,753,912	M1K	probably null	Het
Vmn2r58	C	T	7: 41,837,489	G661R	possibly damaging	Het
Vps41	A	C	13: 18,841,243	D471A	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp462	T	A	4: 55,013,489	F1818L	possibly damaging	Het

Other mutations in Zp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02282:Zp3	APN	5	135984351	missense	possibly damaging	0.72
IGL02563:Zp3	APN	5	135987610	critical splice donor site	probably null
IGL03185:Zp3	APN	5	135982721	missense	possibly damaging	0.94
PIT4280001:Zp3	UTSW	5	135984464	missense	possibly damaging	0.56
R0646:Zp3	UTSW	5	135984356	missense	possibly damaging	0.46
R1454:Zp3	UTSW	5	135984188	missense	probably damaging	1.00
R3415:Zp3	UTSW	5	135985660	missense	probably benign	0.07
R4599:Zp3	UTSW	5	135984235	nonsense	probably null
R4987:Zp3	UTSW	5	135987505	nonsense	probably null
R5907:Zp3	UTSW	5	135988523	missense	probably benign	0.00
R6388:Zp3	UTSW	5	135982694	missense	probably benign	0.02
R6587:Zp3	UTSW	5	135987498	missense	possibly damaging	0.68
R6629:Zp3	UTSW	5	135987336	missense	probably benign	0.00
R7438:Zp3	UTSW	5	135982705	missense	probably damaging	1.00
R8050:Zp3	UTSW	5	135982750	missense	probably damaging	1.00
R8083:Zp3	UTSW	5	135984522	missense	probably damaging	1.00
R8158:Zp3	UTSW	5	135985564	missense	probably benign	0.15
R8421:Zp3	UTSW	5	135988477	missense	probably benign	0.00
R8447:Zp3	UTSW	5	135984390	missense	probably damaging	1.00
R8529:Zp3	UTSW	5	135987265	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTGTCAGCCTCTCATTCTGAGC -3'
(R):5'- CACTCCTGAGCCACAGTGAAAGAAG -3'

Sequencing Primer
(F):5'- CTCTCATTCTGAGCCCAGC -3'
(R):5'- TCAACAGCTCCATTGCCAG -3'

Posted On

2014-05-14