Incidental Mutation 'R1691:Vmn1r174'
ID191782
Institutional Source Beutler Lab
Gene Symbol Vmn1r174
Ensembl Gene ENSMUSG00000090411
Gene Namevomeronasal 1 receptor 174
SynonymsV1rd22
MMRRC Submission 039724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1691 (G1)
Quality Score197
Status Not validated
Chromosome7
Chromosomal Location23752270-23762403 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 23753912 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000154506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167551] [ENSMUST00000228331]
Predicted Effect probably null
Transcript: ENSMUST00000167551
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126478
Gene: ENSMUSG00000090411
AA Change: M1K

DomainStartEndE-ValueType
Pfam:TAS2R 8 300 4e-9 PFAM
Pfam:V1R 43 300 5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228331
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,499,606 S283P probably damaging Het
Adck2 T A 6: 39,574,968 L223* probably null Het
Ank T C 15: 27,590,944 W390R probably damaging Het
Ano5 T C 7: 51,590,579 Y752H probably damaging Het
Apcs T A 1: 172,894,593 D62V probably damaging Het
Atad5 A G 11: 80,095,532 T482A probably benign Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Ccdc13 A T 9: 121,825,068 probably null Het
Ccdc157 G A 11: 4,149,030 P159S probably benign Het
Cdhr3 C T 12: 33,082,247 V126M probably damaging Het
Cdr1 T C X: 61,184,174 D462G possibly damaging Het
Cisd1 A G 10: 71,344,729 V9A probably benign Het
Col19a1 T C 1: 24,536,941 R107G unknown Het
Col1a2 C A 6: 4,536,038 H972Q unknown Het
Col3a1 T A 1: 45,348,616 probably benign Het
Dbnl A G 11: 5,797,174 S235G probably null Het
Dock4 T A 12: 40,725,755 S566T probably benign Het
Efcab6 T C 15: 83,933,206 D722G probably benign Het
Esyt1 T C 10: 128,525,534 Q97R probably benign Het
Fam196a C T 7: 134,918,286 A172T probably damaging Het
Fat2 G A 11: 55,311,852 T132I probably damaging Het
Fgd2 C T 17: 29,378,944 Q618* probably null Het
Flnc T A 6: 29,441,214 V389E probably benign Het
Garnl3 A T 2: 32,997,663 Y778* probably null Het
Gpaa1 A T 15: 76,332,216 Y45F probably damaging Het
Grid1 A T 14: 35,452,329 I643F probably damaging Het
Gsdmc2 T C 15: 63,833,465 D133G probably damaging Het
Hp T C 8: 109,575,572 D248G probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna13 T C 4: 88,644,054 D111G probably benign Het
Il9r T A 11: 32,191,829 Q309L possibly damaging Het
Ints1 A T 5: 139,768,932 D617E probably damaging Het
Kcnj12 A T 11: 61,070,277 N467I possibly damaging Het
Kmt2e T A 5: 23,464,849 D111E probably damaging Het
Lama4 A G 10: 39,080,563 K1161E probably benign Het
Lamc1 C T 1: 153,247,249 D732N probably benign Het
Larp1 A G 11: 58,048,048 T517A probably benign Het
Lrp12 A G 15: 39,872,265 I757T probably damaging Het
Max T C 12: 76,953,272 D23G possibly damaging Het
Nars A T 18: 64,516,414 probably null Het
Nipsnap3a G A 4: 52,994,185 D91N probably null Het
Nphp3 A G 9: 104,002,811 T11A probably benign Het
Nr2c2 C A 6: 92,156,692 T226K probably damaging Het
Nrxn1 A G 17: 90,162,289 I1288T probably damaging Het
Nt5c1b C T 12: 10,375,537 T360I possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1281 G A 2: 111,328,853 V145I probably benign Het
Olfr1505 C T 19: 13,919,419 T133I probably benign Het
Olfr1508 A T 14: 52,463,831 H59Q possibly damaging Het
Olfr214 A G 6: 116,556,577 T51A probably benign Het
Olfr516 A G 7: 108,845,141 Y290H possibly damaging Het
Olfr532 A T 7: 140,418,942 L277Q probably damaging Het
Pcsk1 A G 13: 75,132,225 D723G possibly damaging Het
Phrf1 C A 7: 141,261,874 Y715* probably null Het
Pigm T C 1: 172,376,787 V30A probably benign Het
Pkd1l2 A T 8: 117,056,419 F721I possibly damaging Het
Pla2g15 A G 8: 106,154,949 D70G possibly damaging Het
Prl7d1 A T 13: 27,709,382 I182N probably damaging Het
Prss23 T C 7: 89,510,714 K49R probably benign Het
Rps6 A T 4: 86,856,809 D19E probably benign Het
Slco6d1 A T 1: 98,507,567 H669L probably benign Het
Svil G T 18: 5,056,336 C490F probably benign Het
Tom1 T C 8: 75,051,599 I103T probably damaging Het
Trim10 T A 17: 36,876,899 Y336N probably damaging Het
Trim43c G T 9: 88,840,699 V133F probably damaging Het
Tvp23a A G 16: 10,428,687 L78P possibly damaging Het
Ugt2b38 T A 5: 87,424,132 I14L probably benign Het
Unc5a A C 13: 55,002,924 M520L probably damaging Het
Vmn2r58 C T 7: 41,837,489 G661R possibly damaging Het
Vps41 A C 13: 18,841,243 D471A probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp462 T A 4: 55,013,489 F1818L possibly damaging Het
Zp3 G A 5: 135,980,281 E50K possibly damaging Het
Other mutations in Vmn1r174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Vmn1r174 APN 7 23754533 missense possibly damaging 0.77
IGL00950:Vmn1r174 APN 7 23754486 missense possibly damaging 0.96
IGL01484:Vmn1r174 APN 7 23754324 nonsense probably null
IGL02014:Vmn1r174 APN 7 23754158 missense probably damaging 1.00
IGL02190:Vmn1r174 APN 7 23754827 missense unknown
IGL03265:Vmn1r174 APN 7 23754473 nonsense probably null
IGL03335:Vmn1r174 APN 7 23754512 missense probably benign 0.41
R0529:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1489:Vmn1r174 UTSW 7 23754556 nonsense probably null
R1645:Vmn1r174 UTSW 7 23754352 missense possibly damaging 0.87
R1753:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1939:Vmn1r174 UTSW 7 23754107 missense probably damaging 0.99
R1988:Vmn1r174 UTSW 7 23754625 missense probably damaging 0.98
R2299:Vmn1r174 UTSW 7 23754004 missense probably benign 0.08
R4429:Vmn1r174 UTSW 7 23754140 missense probably benign 0.02
R4516:Vmn1r174 UTSW 7 23754343 missense probably benign 0.01
R4589:Vmn1r174 UTSW 7 23754779 nonsense probably null
R5175:Vmn1r174 UTSW 7 23754728 missense probably benign 0.03
R5392:Vmn1r174 UTSW 7 23754802 missense unknown
R5503:Vmn1r174 UTSW 7 23754137 missense probably benign 0.03
R5568:Vmn1r174 UTSW 7 23754494 missense probably damaging 0.96
R6705:Vmn1r174 UTSW 7 23754426 missense probably benign 0.25
R8168:Vmn1r174 UTSW 7 23754671 missense probably damaging 0.99
R8190:Vmn1r174 UTSW 7 23754143 missense probably damaging 1.00
X0011:Vmn1r174 UTSW 7 23754481 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTGTTCACATGTACACCAGAGTCC -3'
(R):5'- TGTTTGCACTTCGAGCCACCAG -3'

Sequencing Primer
(F):5'- CACCAGAGTCCATGTTAAAATGTGTG -3'
(R):5'- CATATTGCTTGGAAACCCAGTGAG -3'
Posted On2014-05-14