Incidental Mutation 'R1691:Olfr516'
ID191787
Institutional Source Beutler Lab
Gene Symbol Olfr516
Ensembl Gene ENSMUSG00000062434
Gene Nameolfactory receptor 516
SynonymsGA_x6K02T2PBJ9-11176324-11175380, MOR268-2
MMRRC Submission 039724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1691 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108844788-108850529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108845141 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 290 (Y290H)
Ref Sequence ENSEMBL: ENSMUSP00000150359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071410] [ENSMUST00000216092] [ENSMUST00000217279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071410
AA Change: Y290H

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071358
Gene: ENSMUSG00000062434
AA Change: Y290H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-5 PFAM
Pfam:7tm_1 41 290 9.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208389
Predicted Effect possibly damaging
Transcript: ENSMUST00000216092
AA Change: Y290H

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217279
AA Change: Y290H

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,499,606 S283P probably damaging Het
Adck2 T A 6: 39,574,968 L223* probably null Het
Ank T C 15: 27,590,944 W390R probably damaging Het
Ano5 T C 7: 51,590,579 Y752H probably damaging Het
Apcs T A 1: 172,894,593 D62V probably damaging Het
Atad5 A G 11: 80,095,532 T482A probably benign Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Ccdc13 A T 9: 121,825,068 probably null Het
Ccdc157 G A 11: 4,149,030 P159S probably benign Het
Cdhr3 C T 12: 33,082,247 V126M probably damaging Het
Cdr1 T C X: 61,184,174 D462G possibly damaging Het
Cisd1 A G 10: 71,344,729 V9A probably benign Het
Col19a1 T C 1: 24,536,941 R107G unknown Het
Col1a2 C A 6: 4,536,038 H972Q unknown Het
Col3a1 T A 1: 45,348,616 probably benign Het
Dbnl A G 11: 5,797,174 S235G probably null Het
Dock4 T A 12: 40,725,755 S566T probably benign Het
Efcab6 T C 15: 83,933,206 D722G probably benign Het
Esyt1 T C 10: 128,525,534 Q97R probably benign Het
Fam196a C T 7: 134,918,286 A172T probably damaging Het
Fat2 G A 11: 55,311,852 T132I probably damaging Het
Fgd2 C T 17: 29,378,944 Q618* probably null Het
Flnc T A 6: 29,441,214 V389E probably benign Het
Garnl3 A T 2: 32,997,663 Y778* probably null Het
Gpaa1 A T 15: 76,332,216 Y45F probably damaging Het
Grid1 A T 14: 35,452,329 I643F probably damaging Het
Gsdmc2 T C 15: 63,833,465 D133G probably damaging Het
Hp T C 8: 109,575,572 D248G probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna13 T C 4: 88,644,054 D111G probably benign Het
Il9r T A 11: 32,191,829 Q309L possibly damaging Het
Ints1 A T 5: 139,768,932 D617E probably damaging Het
Kcnj12 A T 11: 61,070,277 N467I possibly damaging Het
Kmt2e T A 5: 23,464,849 D111E probably damaging Het
Lama4 A G 10: 39,080,563 K1161E probably benign Het
Lamc1 C T 1: 153,247,249 D732N probably benign Het
Larp1 A G 11: 58,048,048 T517A probably benign Het
Lrp12 A G 15: 39,872,265 I757T probably damaging Het
Max T C 12: 76,953,272 D23G possibly damaging Het
Nars A T 18: 64,516,414 probably null Het
Nipsnap3a G A 4: 52,994,185 D91N probably null Het
Nphp3 A G 9: 104,002,811 T11A probably benign Het
Nr2c2 C A 6: 92,156,692 T226K probably damaging Het
Nrxn1 A G 17: 90,162,289 I1288T probably damaging Het
Nt5c1b C T 12: 10,375,537 T360I possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1281 G A 2: 111,328,853 V145I probably benign Het
Olfr1505 C T 19: 13,919,419 T133I probably benign Het
Olfr1508 A T 14: 52,463,831 H59Q possibly damaging Het
Olfr214 A G 6: 116,556,577 T51A probably benign Het
Olfr532 A T 7: 140,418,942 L277Q probably damaging Het
Pcsk1 A G 13: 75,132,225 D723G possibly damaging Het
Phrf1 C A 7: 141,261,874 Y715* probably null Het
Pigm T C 1: 172,376,787 V30A probably benign Het
Pkd1l2 A T 8: 117,056,419 F721I possibly damaging Het
Pla2g15 A G 8: 106,154,949 D70G possibly damaging Het
Prl7d1 A T 13: 27,709,382 I182N probably damaging Het
Prss23 T C 7: 89,510,714 K49R probably benign Het
Rps6 A T 4: 86,856,809 D19E probably benign Het
Slco6d1 A T 1: 98,507,567 H669L probably benign Het
Svil G T 18: 5,056,336 C490F probably benign Het
Tom1 T C 8: 75,051,599 I103T probably damaging Het
Trim10 T A 17: 36,876,899 Y336N probably damaging Het
Trim43c G T 9: 88,840,699 V133F probably damaging Het
Tvp23a A G 16: 10,428,687 L78P possibly damaging Het
Ugt2b38 T A 5: 87,424,132 I14L probably benign Het
Unc5a A C 13: 55,002,924 M520L probably damaging Het
Vmn1r174 T A 7: 23,753,912 M1K probably null Het
Vmn2r58 C T 7: 41,837,489 G661R possibly damaging Het
Vps41 A C 13: 18,841,243 D471A probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp462 T A 4: 55,013,489 F1818L possibly damaging Het
Zp3 G A 5: 135,980,281 E50K possibly damaging Het
Other mutations in Olfr516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Olfr516 APN 7 108845680 missense probably damaging 0.99
R0583:Olfr516 UTSW 7 108845414 missense possibly damaging 0.87
R0939:Olfr516 UTSW 7 108845233 missense probably damaging 1.00
R1037:Olfr516 UTSW 7 108845984 missense probably benign 0.04
R1631:Olfr516 UTSW 7 108845857 missense probably damaging 1.00
R5153:Olfr516 UTSW 7 108845699 missense probably benign 0.03
R6114:Olfr516 UTSW 7 108845386 missense possibly damaging 0.53
R6305:Olfr516 UTSW 7 108845554 missense possibly damaging 0.87
R6808:Olfr516 UTSW 7 108845540 missense probably benign 0.01
R6896:Olfr516 UTSW 7 108845543 missense probably benign
R7544:Olfr516 UTSW 7 108845321 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGCAGTGATTGGGATGCAGAGTAAAT -3'
(R):5'- TCCACTACAGGGAGGCAGAAGG -3'

Sequencing Primer
(F):5'- GCAGTCATCAGTACACCAATAATAG -3'
(R):5'- AAGGCCTTTTCCACGTGT -3'
Posted On2014-05-14