Incidental Mutation 'R1691:Nphp3'
ID191798
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission 039724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1691 (G1)
Quality Score102
Status Not validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104002811 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 11 (T11A)
Ref Sequence ENSEMBL: ENSMUSP00000141540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
Predicted Effect probably benign
Transcript: ENSMUST00000035167
AA Change: T11A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: T11A

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191919
Predicted Effect probably benign
Transcript: ENSMUST00000193439
AA Change: T11A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: T11A

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect probably benign
Transcript: ENSMUST00000194774
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216588
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,499,606 S283P probably damaging Het
Adck2 T A 6: 39,574,968 L223* probably null Het
Ank T C 15: 27,590,944 W390R probably damaging Het
Ano5 T C 7: 51,590,579 Y752H probably damaging Het
Apcs T A 1: 172,894,593 D62V probably damaging Het
Atad5 A G 11: 80,095,532 T482A probably benign Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Ccdc13 A T 9: 121,825,068 probably null Het
Ccdc157 G A 11: 4,149,030 P159S probably benign Het
Cdhr3 C T 12: 33,082,247 V126M probably damaging Het
Cdr1 T C X: 61,184,174 D462G possibly damaging Het
Cisd1 A G 10: 71,344,729 V9A probably benign Het
Col19a1 T C 1: 24,536,941 R107G unknown Het
Col1a2 C A 6: 4,536,038 H972Q unknown Het
Col3a1 T A 1: 45,348,616 probably benign Het
Dbnl A G 11: 5,797,174 S235G probably null Het
Dock4 T A 12: 40,725,755 S566T probably benign Het
Efcab6 T C 15: 83,933,206 D722G probably benign Het
Esyt1 T C 10: 128,525,534 Q97R probably benign Het
Fam196a C T 7: 134,918,286 A172T probably damaging Het
Fat2 G A 11: 55,311,852 T132I probably damaging Het
Fgd2 C T 17: 29,378,944 Q618* probably null Het
Flnc T A 6: 29,441,214 V389E probably benign Het
Garnl3 A T 2: 32,997,663 Y778* probably null Het
Gpaa1 A T 15: 76,332,216 Y45F probably damaging Het
Grid1 A T 14: 35,452,329 I643F probably damaging Het
Gsdmc2 T C 15: 63,833,465 D133G probably damaging Het
Hp T C 8: 109,575,572 D248G probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna13 T C 4: 88,644,054 D111G probably benign Het
Il9r T A 11: 32,191,829 Q309L possibly damaging Het
Ints1 A T 5: 139,768,932 D617E probably damaging Het
Kcnj12 A T 11: 61,070,277 N467I possibly damaging Het
Kmt2e T A 5: 23,464,849 D111E probably damaging Het
Lama4 A G 10: 39,080,563 K1161E probably benign Het
Lamc1 C T 1: 153,247,249 D732N probably benign Het
Larp1 A G 11: 58,048,048 T517A probably benign Het
Lrp12 A G 15: 39,872,265 I757T probably damaging Het
Max T C 12: 76,953,272 D23G possibly damaging Het
Nars A T 18: 64,516,414 probably null Het
Nipsnap3a G A 4: 52,994,185 D91N probably null Het
Nr2c2 C A 6: 92,156,692 T226K probably damaging Het
Nrxn1 A G 17: 90,162,289 I1288T probably damaging Het
Nt5c1b C T 12: 10,375,537 T360I possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1281 G A 2: 111,328,853 V145I probably benign Het
Olfr1505 C T 19: 13,919,419 T133I probably benign Het
Olfr1508 A T 14: 52,463,831 H59Q possibly damaging Het
Olfr214 A G 6: 116,556,577 T51A probably benign Het
Olfr516 A G 7: 108,845,141 Y290H possibly damaging Het
Olfr532 A T 7: 140,418,942 L277Q probably damaging Het
Pcsk1 A G 13: 75,132,225 D723G possibly damaging Het
Phrf1 C A 7: 141,261,874 Y715* probably null Het
Pigm T C 1: 172,376,787 V30A probably benign Het
Pkd1l2 A T 8: 117,056,419 F721I possibly damaging Het
Pla2g15 A G 8: 106,154,949 D70G possibly damaging Het
Prl7d1 A T 13: 27,709,382 I182N probably damaging Het
Prss23 T C 7: 89,510,714 K49R probably benign Het
Rps6 A T 4: 86,856,809 D19E probably benign Het
Slco6d1 A T 1: 98,507,567 H669L probably benign Het
Svil G T 18: 5,056,336 C490F probably benign Het
Tom1 T C 8: 75,051,599 I103T probably damaging Het
Trim10 T A 17: 36,876,899 Y336N probably damaging Het
Trim43c G T 9: 88,840,699 V133F probably damaging Het
Tvp23a A G 16: 10,428,687 L78P possibly damaging Het
Ugt2b38 T A 5: 87,424,132 I14L probably benign Het
Unc5a A C 13: 55,002,924 M520L probably damaging Het
Vmn1r174 T A 7: 23,753,912 M1K probably null Het
Vmn2r58 C T 7: 41,837,489 G661R possibly damaging Het
Vps41 A C 13: 18,841,243 D471A probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp462 T A 4: 55,013,489 F1818L possibly damaging Het
Zp3 G A 5: 135,980,281 E50K possibly damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAAGACGGCCACTCTTCTTCAAC -3'
(R):5'- CTTGCTGACCCGGAAGATCTCATAC -3'

Sequencing Primer
(F):5'- AGTTGCCACGTTACGCC -3'
(R):5'- GGAAGATCTCATACTCTTTCTTGAGC -3'
Posted On2014-05-14