Mutagenetix > Incidental Mutations

Incidental Mutation 'R1691:Nphp3'

191798

Institutional Source

Beutler Lab

Gene Symbol

Nphp3

Ensembl Gene

ENSMUSG00000032558

Gene Name

nephronophthisis 3 (adolescent)

Synonyms

3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3

MMRRC Submission

039724-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1691 (G1)

Quality Score

102

Status

Not validated

Chromosome

Chromosomal Location

104002544-104043818 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104002811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 11 (T11A)

Ref Sequence

ENSEMBL: ENSMUSP00000141540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]

AlphaFold

Q7TNH6

Predicted Effect

probably benign
Transcript: ENSMUST00000035167
AA Change: T11A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: T11A

Domain	Start	End	E-Value	Type
low complexity region	46	69	N/A	INTRINSIC
coiled coil region	107	203	N/A	INTRINSIC
low complexity region	512	537	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	640	650	N/A	INTRINSIC
TPR	938	971	3.16e1	SMART
TPR	980	1013	7.74e-2	SMART
TPR	1022	1055	3.24e1	SMART
low complexity region	1066	1080	N/A	INTRINSIC
TPR	1088	1121	3.67e-3	SMART
TPR	1130	1163	1.3e-3	SMART
TPR	1172	1205	4.38e-1	SMART
TPR	1214	1247	8.69e-5	SMART
TPR	1256	1289	9.03e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191919

Predicted Effect

probably benign
Transcript: ENSMUST00000193439
AA Change: T11A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: T11A

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193642

Predicted Effect

probably benign
Transcript: ENSMUST00000194774

SMART Domains

Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	49	83	N/A	INTRINSIC
Pfam:NACHT	400	559	2e-6	PFAM
TPR	818	851	3.16e1	SMART
TPR	860	893	7.74e-2	SMART
TPR	902	935	3.24e1	SMART
low complexity region	946	960	N/A	INTRINSIC
TPR	968	1001	3.67e-3	SMART
TPR	1010	1043	1.3e-3	SMART
TPR	1052	1085	4.38e-1	SMART
TPR	1094	1127	8.69e-5	SMART
TPR	1136	1169	9.03e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216588

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	T	C	7: 82,499,606	S283P	probably damaging	Het
Adck2	T	A	6: 39,574,968	L223*	probably null	Het
Ank	T	C	15: 27,590,944	W390R	probably damaging	Het
Ano5	T	C	7: 51,590,579	Y752H	probably damaging	Het
Apcs	T	A	1: 172,894,593	D62V	probably damaging	Het
Atad5	A	G	11: 80,095,532	T482A	probably benign	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Ccdc13	A	T	9: 121,825,068		probably null	Het
Ccdc157	G	A	11: 4,149,030	P159S	probably benign	Het
Cdhr3	C	T	12: 33,082,247	V126M	probably damaging	Het
Cdr1	T	C	X: 61,184,174	D462G	possibly damaging	Het
Cisd1	A	G	10: 71,344,729	V9A	probably benign	Het
Col19a1	T	C	1: 24,536,941	R107G	unknown	Het
Col1a2	C	A	6: 4,536,038	H972Q	unknown	Het
Col3a1	T	A	1: 45,348,616		probably benign	Het
Dbnl	A	G	11: 5,797,174	S235G	probably null	Het
Dock4	T	A	12: 40,725,755	S566T	probably benign	Het
Efcab6	T	C	15: 83,933,206	D722G	probably benign	Het
Esyt1	T	C	10: 128,525,534	Q97R	probably benign	Het
Fam196a	C	T	7: 134,918,286	A172T	probably damaging	Het
Fat2	G	A	11: 55,311,852	T132I	probably damaging	Het
Fgd2	C	T	17: 29,378,944	Q618*	probably null	Het
Flnc	T	A	6: 29,441,214	V389E	probably benign	Het
Garnl3	A	T	2: 32,997,663	Y778*	probably null	Het
Gpaa1	A	T	15: 76,332,216	Y45F	probably damaging	Het
Grid1	A	T	14: 35,452,329	I643F	probably damaging	Het
Gsdmc2	T	C	15: 63,833,465	D133G	probably damaging	Het
Hp	T	C	8: 109,575,572	D248G	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifna13	T	C	4: 88,644,054	D111G	probably benign	Het
Il9r	T	A	11: 32,191,829	Q309L	possibly damaging	Het
Ints1	A	T	5: 139,768,932	D617E	probably damaging	Het
Kcnj12	A	T	11: 61,070,277	N467I	possibly damaging	Het
Kmt2e	T	A	5: 23,464,849	D111E	probably damaging	Het
Lama4	A	G	10: 39,080,563	K1161E	probably benign	Het
Lamc1	C	T	1: 153,247,249	D732N	probably benign	Het
Larp1	A	G	11: 58,048,048	T517A	probably benign	Het
Lrp12	A	G	15: 39,872,265	I757T	probably damaging	Het
Max	T	C	12: 76,953,272	D23G	possibly damaging	Het
Nars	A	T	18: 64,516,414		probably null	Het
Nipsnap3a	G	A	4: 52,994,185	D91N	probably null	Het
Nr2c2	C	A	6: 92,156,692	T226K	probably damaging	Het
Nrxn1	A	G	17: 90,162,289	I1288T	probably damaging	Het
Nt5c1b	C	T	12: 10,375,537	T360I	possibly damaging	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1281	G	A	2: 111,328,853	V145I	probably benign	Het
Olfr1505	C	T	19: 13,919,419	T133I	probably benign	Het
Olfr1508	A	T	14: 52,463,831	H59Q	possibly damaging	Het
Olfr214	A	G	6: 116,556,577	T51A	probably benign	Het
Olfr516	A	G	7: 108,845,141	Y290H	possibly damaging	Het
Olfr532	A	T	7: 140,418,942	L277Q	probably damaging	Het
Pcsk1	A	G	13: 75,132,225	D723G	possibly damaging	Het
Phrf1	C	A	7: 141,261,874	Y715*	probably null	Het
Pigm	T	C	1: 172,376,787	V30A	probably benign	Het
Pkd1l2	A	T	8: 117,056,419	F721I	possibly damaging	Het
Pla2g15	A	G	8: 106,154,949	D70G	possibly damaging	Het
Prl7d1	A	T	13: 27,709,382	I182N	probably damaging	Het
Prss23	T	C	7: 89,510,714	K49R	probably benign	Het
Rps6	A	T	4: 86,856,809	D19E	probably benign	Het
Slco6d1	A	T	1: 98,507,567	H669L	probably benign	Het
Svil	G	T	18: 5,056,336	C490F	probably benign	Het
Tom1	T	C	8: 75,051,599	I103T	probably damaging	Het
Trim10	T	A	17: 36,876,899	Y336N	probably damaging	Het
Trim43c	G	T	9: 88,840,699	V133F	probably damaging	Het
Tvp23a	A	G	16: 10,428,687	L78P	possibly damaging	Het
Ugt2b38	T	A	5: 87,424,132	I14L	probably benign	Het
Unc5a	A	C	13: 55,002,924	M520L	probably damaging	Het
Vmn1r174	T	A	7: 23,753,912	M1K	probably null	Het
Vmn2r58	C	T	7: 41,837,489	G661R	possibly damaging	Het
Vps41	A	C	13: 18,841,243	D471A	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp462	T	A	4: 55,013,489	F1818L	possibly damaging	Het
Zp3	G	A	5: 135,980,281	E50K	possibly damaging	Het

Other mutations in Nphp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01707:Nphp3	APN	9	104018158	missense	possibly damaging	0.75
IGL02329:Nphp3	APN	9	104025968	missense	probably benign	0.19
lithograph	UTSW	9	104041990	missense	probably damaging	1.00
F5770:Nphp3	UTSW	9	104035894	critical splice donor site	probably null
FR4548:Nphp3	UTSW	9	104025939	small deletion	probably benign
FR4589:Nphp3	UTSW	9	104025939	small deletion	probably benign
R0112:Nphp3	UTSW	9	104037348	missense	possibly damaging	0.80
R0555:Nphp3	UTSW	9	104023434	missense	probably damaging	1.00
R0632:Nphp3	UTSW	9	104018274	missense	probably damaging	1.00
R0674:Nphp3	UTSW	9	104036282	critical splice donor site	probably null
R0743:Nphp3	UTSW	9	104022768	small deletion	probably benign
R0853:Nphp3	UTSW	9	104031933	missense	probably benign	0.03
R0920:Nphp3	UTSW	9	104031907	missense	probably benign	0.00
R1420:Nphp3	UTSW	9	104035893	critical splice donor site	probably null
R1464:Nphp3	UTSW	9	104031879	splice site	probably benign
R1476:Nphp3	UTSW	9	104025927	missense	possibly damaging	0.81
R1585:Nphp3	UTSW	9	104009214	missense	probably damaging	1.00
R1608:Nphp3	UTSW	9	104035840	missense	probably benign	0.30
R1688:Nphp3	UTSW	9	104003124	missense	probably damaging	1.00
R1807:Nphp3	UTSW	9	104020741	missense	probably benign	0.01
R1857:Nphp3	UTSW	9	104021294	missense	possibly damaging	0.87
R1962:Nphp3	UTSW	9	104021338	missense	probably benign	0.00
R2127:Nphp3	UTSW	9	104008243	missense	probably damaging	0.98
R2138:Nphp3	UTSW	9	104025903	missense	possibly damaging	0.89
R2233:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R2234:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R3861:Nphp3	UTSW	9	104039326	unclassified	probably benign
R3928:Nphp3	UTSW	9	104011730	missense	probably damaging	0.99
R3961:Nphp3	UTSW	9	104003042	nonsense	probably null
R4182:Nphp3	UTSW	9	104038464	missense	probably benign	0.06
R4294:Nphp3	UTSW	9	104022717	missense	probably damaging	1.00
R4387:Nphp3	UTSW	9	104030020	missense	possibly damaging	0.94
R4625:Nphp3	UTSW	9	104036159	missense	possibly damaging	0.66
R4628:Nphp3	UTSW	9	104003058	missense	probably damaging	0.99
R4696:Nphp3	UTSW	9	104022732	missense	probably benign	0.01
R4865:Nphp3	UTSW	9	104031970	missense	probably benign
R4886:Nphp3	UTSW	9	104002994	missense	probably damaging	1.00
R4973:Nphp3	UTSW	9	104031999	missense	probably benign
R5445:Nphp3	UTSW	9	104004723	missense	probably damaging	1.00
R5451:Nphp3	UTSW	9	104042022	missense	probably benign
R5520:Nphp3	UTSW	9	104024673	missense	probably benign	0.30
R5641:Nphp3	UTSW	9	104036153	missense	probably damaging	1.00
R5847:Nphp3	UTSW	9	104003037	missense	probably damaging	1.00
R5928:Nphp3	UTSW	9	104035797	missense	probably benign	0.01
R5931:Nphp3	UTSW	9	104020746	missense	probably damaging	1.00
R6161:Nphp3	UTSW	9	104031906	missense	probably benign	0.11
R6298:Nphp3	UTSW	9	104015441	missense	probably damaging	1.00
R6890:Nphp3	UTSW	9	104041954	missense	probably damaging	0.96
R7009:Nphp3	UTSW	9	104016116	missense	probably null	0.00
R7065:Nphp3	UTSW	9	104041990	missense	probably damaging	1.00
R7146:Nphp3	UTSW	9	104004837	nonsense	probably null
R7198:Nphp3	UTSW	9	104004775	missense	probably damaging	1.00
R7360:Nphp3	UTSW	9	104016078	critical splice acceptor site	probably null
R7369:Nphp3	UTSW	9	104018250	missense	probably damaging	0.99
R7554:Nphp3	UTSW	9	104042071	missense	probably damaging	0.98
R7591:Nphp3	UTSW	9	104018278	critical splice donor site	probably null
R7665:Nphp3	UTSW	9	104005393	splice site	probably null
R7672:Nphp3	UTSW	9	104031960	missense	probably benign
R7675:Nphp3	UTSW	9	104016088	missense	probably benign
R8039:Nphp3	UTSW	9	104031963	missense	probably benign
R8145:Nphp3	UTSW	9	104035851	missense	probably benign	0.16
R8211:Nphp3	UTSW	9	104031897	missense	possibly damaging	0.80
R8882:Nphp3	UTSW	9	104005594	missense	possibly damaging	0.77
R9020:Nphp3	UTSW	9	104031951	missense	probably benign	0.00
R9132:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9135:Nphp3	UTSW	9	104032015	missense	probably damaging	0.99
R9159:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9204:Nphp3	UTSW	9	104042106	missense	probably benign
R9226:Nphp3	UTSW	9	104008129	missense	probably benign	0.00
R9229:Nphp3	UTSW	9	104036177	missense	probably damaging	1.00
V7583:Nphp3	UTSW	9	104035894	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCAAGACGGCCACTCTTCTTCAAC -3'
(R):5'- CTTGCTGACCCGGAAGATCTCATAC -3'

Sequencing Primer
(F):5'- AGTTGCCACGTTACGCC -3'
(R):5'- GGAAGATCTCATACTCTTTCTTGAGC -3'

Posted On

2014-05-14