Mutagenetix > Incidental Mutations

Incidental Mutation 'R1691:Grid1'

191823

Institutional Source

Beutler Lab

Gene Symbol

Grid1

Ensembl Gene

ENSMUSG00000041078

Gene Name

glutamate receptor, ionotropic, delta 1

Synonyms

GluRdelta1

MMRRC Submission

039724-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R1691 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34820108-35583379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35452329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 643 (I643F)

Ref Sequence

ENSEMBL: ENSMUSP00000044009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043349]

AlphaFold

Q61627

Predicted Effect

probably damaging
Transcript: ENSMUST00000043349
AA Change: I643F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: I643F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	36	400	4.1e-51	PFAM
PBPe	438	807	4.68e-110	SMART
Lig_chan-Glu_bd	448	510	8.18e-25	SMART
low complexity region	838	853	N/A	INTRINSIC
low complexity region	943	958	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227253

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	T	C	7: 82,499,606	S283P	probably damaging	Het
Adck2	T	A	6: 39,574,968	L223*	probably null	Het
Ank	T	C	15: 27,590,944	W390R	probably damaging	Het
Ano5	T	C	7: 51,590,579	Y752H	probably damaging	Het
Apcs	T	A	1: 172,894,593	D62V	probably damaging	Het
Atad5	A	G	11: 80,095,532	T482A	probably benign	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Ccdc13	A	T	9: 121,825,068		probably null	Het
Ccdc157	G	A	11: 4,149,030	P159S	probably benign	Het
Cdhr3	C	T	12: 33,082,247	V126M	probably damaging	Het
Cdr1	T	C	X: 61,184,174	D462G	possibly damaging	Het
Cisd1	A	G	10: 71,344,729	V9A	probably benign	Het
Col19a1	T	C	1: 24,536,941	R107G	unknown	Het
Col1a2	C	A	6: 4,536,038	H972Q	unknown	Het
Col3a1	T	A	1: 45,348,616		probably benign	Het
Dbnl	A	G	11: 5,797,174	S235G	probably null	Het
Dock4	T	A	12: 40,725,755	S566T	probably benign	Het
Efcab6	T	C	15: 83,933,206	D722G	probably benign	Het
Esyt1	T	C	10: 128,525,534	Q97R	probably benign	Het
Fam196a	C	T	7: 134,918,286	A172T	probably damaging	Het
Fat2	G	A	11: 55,311,852	T132I	probably damaging	Het
Fgd2	C	T	17: 29,378,944	Q618*	probably null	Het
Flnc	T	A	6: 29,441,214	V389E	probably benign	Het
Garnl3	A	T	2: 32,997,663	Y778*	probably null	Het
Gpaa1	A	T	15: 76,332,216	Y45F	probably damaging	Het
Gsdmc2	T	C	15: 63,833,465	D133G	probably damaging	Het
Hp	T	C	8: 109,575,572	D248G	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifna13	T	C	4: 88,644,054	D111G	probably benign	Het
Il9r	T	A	11: 32,191,829	Q309L	possibly damaging	Het
Ints1	A	T	5: 139,768,932	D617E	probably damaging	Het
Kcnj12	A	T	11: 61,070,277	N467I	possibly damaging	Het
Kmt2e	T	A	5: 23,464,849	D111E	probably damaging	Het
Lama4	A	G	10: 39,080,563	K1161E	probably benign	Het
Lamc1	C	T	1: 153,247,249	D732N	probably benign	Het
Larp1	A	G	11: 58,048,048	T517A	probably benign	Het
Lrp12	A	G	15: 39,872,265	I757T	probably damaging	Het
Max	T	C	12: 76,953,272	D23G	possibly damaging	Het
Nars	A	T	18: 64,516,414		probably null	Het
Nipsnap3a	G	A	4: 52,994,185	D91N	probably null	Het
Nphp3	A	G	9: 104,002,811	T11A	probably benign	Het
Nr2c2	C	A	6: 92,156,692	T226K	probably damaging	Het
Nrxn1	A	G	17: 90,162,289	I1288T	probably damaging	Het
Nt5c1b	C	T	12: 10,375,537	T360I	possibly damaging	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1281	G	A	2: 111,328,853	V145I	probably benign	Het
Olfr1505	C	T	19: 13,919,419	T133I	probably benign	Het
Olfr1508	A	T	14: 52,463,831	H59Q	possibly damaging	Het
Olfr214	A	G	6: 116,556,577	T51A	probably benign	Het
Olfr516	A	G	7: 108,845,141	Y290H	possibly damaging	Het
Olfr532	A	T	7: 140,418,942	L277Q	probably damaging	Het
Pcsk1	A	G	13: 75,132,225	D723G	possibly damaging	Het
Phrf1	C	A	7: 141,261,874	Y715*	probably null	Het
Pigm	T	C	1: 172,376,787	V30A	probably benign	Het
Pkd1l2	A	T	8: 117,056,419	F721I	possibly damaging	Het
Pla2g15	A	G	8: 106,154,949	D70G	possibly damaging	Het
Prl7d1	A	T	13: 27,709,382	I182N	probably damaging	Het
Prss23	T	C	7: 89,510,714	K49R	probably benign	Het
Rps6	A	T	4: 86,856,809	D19E	probably benign	Het
Slco6d1	A	T	1: 98,507,567	H669L	probably benign	Het
Svil	G	T	18: 5,056,336	C490F	probably benign	Het
Tom1	T	C	8: 75,051,599	I103T	probably damaging	Het
Trim10	T	A	17: 36,876,899	Y336N	probably damaging	Het
Trim43c	G	T	9: 88,840,699	V133F	probably damaging	Het
Tvp23a	A	G	16: 10,428,687	L78P	possibly damaging	Het
Ugt2b38	T	A	5: 87,424,132	I14L	probably benign	Het
Unc5a	A	C	13: 55,002,924	M520L	probably damaging	Het
Vmn1r174	T	A	7: 23,753,912	M1K	probably null	Het
Vmn2r58	C	T	7: 41,837,489	G661R	possibly damaging	Het
Vps41	A	C	13: 18,841,243	D471A	probably damaging	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp462	T	A	4: 55,013,489	F1818L	possibly damaging	Het
Zp3	G	A	5: 135,980,281	E50K	possibly damaging	Het

Other mutations in Grid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Grid1	APN	14	35445887	missense	possibly damaging	0.70
IGL01016:Grid1	APN	14	34822639	nonsense	probably null
IGL01643:Grid1	APN	14	35323435	critical splice donor site	probably null
IGL01697:Grid1	APN	14	35309257	missense	probably benign	0.21
IGL01879:Grid1	APN	14	35450370	missense	possibly damaging	0.93
IGL01975:Grid1	APN	14	35323426	missense	probably benign
IGL02515:Grid1	APN	14	35452345	missense	probably damaging	0.99
IGL02935:Grid1	APN	14	34822558	missense	possibly damaging	0.86
IGL03279:Grid1	APN	14	34945765	missense	probably damaging	0.98
IGL03286:Grid1	APN	14	35520685	splice site	probably benign
IGL03296:Grid1	APN	14	35580567	missense	possibly damaging	0.52
IGL03305:Grid1	APN	14	35251707	missense	probably damaging	1.00
R0533:Grid1	UTSW	14	35309385	missense	possibly damaging	0.84
R0746:Grid1	UTSW	14	34822690	missense	possibly damaging	0.92
R0811:Grid1	UTSW	14	34822619	missense	probably benign
R0812:Grid1	UTSW	14	34822619	missense	probably benign
R1144:Grid1	UTSW	14	35562676	splice site	probably benign
R1217:Grid1	UTSW	14	34820229	start codon destroyed	probably null	0.53
R1485:Grid1	UTSW	14	34822583	missense	probably damaging	1.00
R1529:Grid1	UTSW	14	35309293	missense	probably benign	0.36
R1606:Grid1	UTSW	14	35445965	missense	probably damaging	0.96
R1759:Grid1	UTSW	14	35446031	missense	possibly damaging	0.92
R2374:Grid1	UTSW	14	35321807	splice site	probably benign
R2415:Grid1	UTSW	14	35450369	missense	possibly damaging	0.69
R2866:Grid1	UTSW	14	35562559	missense	probably damaging	1.00
R3915:Grid1	UTSW	14	35520727	missense	probably damaging	1.00
R4044:Grid1	UTSW	14	35450401	splice site	probably benign
R4364:Grid1	UTSW	14	34946032	missense	probably benign	0.20
R4691:Grid1	UTSW	14	35569557	missense	probably benign
R4694:Grid1	UTSW	14	35026780	missense	probably damaging	1.00
R4749:Grid1	UTSW	14	35580687	missense	possibly damaging	0.50
R4794:Grid1	UTSW	14	34822622	missense	probably damaging	0.99
R4854:Grid1	UTSW	14	35321641	missense	probably benign
R5555:Grid1	UTSW	14	35520705	missense	possibly damaging	0.92
R6005:Grid1	UTSW	14	35323412	missense	probably damaging	1.00
R6176:Grid1	UTSW	14	35562547	missense	probably benign	0.00
R6569:Grid1	UTSW	14	35323339	missense	possibly damaging	0.72
R6911:Grid1	UTSW	14	34820228	start codon destroyed	probably benign	0.08
R7504:Grid1	UTSW	14	35562513	missense	probably damaging	1.00
R7744:Grid1	UTSW	14	35450079	missense	probably damaging	1.00
R7795:Grid1	UTSW	14	35321685	missense	probably damaging	1.00
R7883:Grid1	UTSW	14	35450302	splice site	probably null
R7913:Grid1	UTSW	14	35569697	missense	probably damaging	0.99
R8032:Grid1	UTSW	14	35323359	missense	probably benign	0.00
R8333:Grid1	UTSW	14	35569638	missense	possibly damaging	0.82
R8916:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8928:Grid1	UTSW	14	35580766	missense	probably benign	0.25
R8934:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8935:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8939:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8986:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8993:Grid1	UTSW	14	35026942	missense	probably benign	0.00
R9238:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9310:Grid1	UTSW	14	35026805	missense	probably damaging	1.00
R9332:Grid1	UTSW	14	35323403	missense	probably benign	0.06
R9335:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9336:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
U24488:Grid1	UTSW	14	35580577	missense	probably benign	0.00
Z1088:Grid1	UTSW	14	35452294	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCCTGAAAGTTCTTGCCATGATG -3'
(R):5'- TGTCCACTTGCAGAGGCTAGGTATG -3'

Sequencing Primer
(F):5'- GCCATGATGAGATAGAATCTTCTTCC -3'
(R):5'- ATGTGTCTGGCTCTGCCTG -3'

Posted On

2014-05-14