Incidental Mutation 'R1692:Map7d1'
ID191850
Institutional Source Beutler Lab
Gene Symbol Map7d1
Ensembl Gene ENSMUSG00000028849
Gene NameMAP7 domain containing 1
SynonymsMtap7d1, Parcc1, Rprc1
MMRRC Submission 039725-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R1692 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126232167-126256343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126242308 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 36 (P36S)
Ref Sequence ENSEMBL: ENSMUSP00000101738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061143] [ENSMUST00000106132] [ENSMUST00000122129]
Predicted Effect probably damaging
Transcript: ENSMUST00000061143
AA Change: P36S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054338
Gene: ENSMUSG00000028849
AA Change: P36S

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 323 343 N/A INTRINSIC
coiled coil region 414 444 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 533 558 N/A INTRINSIC
Pfam:MAP7 587 735 7.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106132
AA Change: P36S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101738
Gene: ENSMUSG00000028849
AA Change: P36S

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 342 372 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
low complexity region 408 425 N/A INTRINSIC
low complexity region 461 486 N/A INTRINSIC
Pfam:MAP7 510 668 1.4e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122129
AA Change: P36S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113250
Gene: ENSMUSG00000028849
AA Change: P36S

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 382 412 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
low complexity region 448 465 N/A INTRINSIC
low complexity region 501 526 N/A INTRINSIC
Pfam:MAP7 550 708 1.5e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125981
SMART Domains Protein: ENSMUSP00000120292
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 68 88 N/A INTRINSIC
coiled coil region 158 188 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 278 303 N/A INTRINSIC
Pfam:MAP7 332 480 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam12 A T 7: 133,887,944 *582R probably null Het
Agfg2 A G 5: 137,664,371 Y145H probably damaging Het
Aldh1a1 C T 19: 20,630,818 P335S probably damaging Het
Amotl1 T C 9: 14,551,722 R732G possibly damaging Het
Ankef1 A T 2: 136,550,426 I512F probably benign Het
Atg9a A T 1: 75,190,355 D17E probably benign Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cd79a T A 7: 24,901,456 M192K probably damaging Het
Clcn1 T G 6: 42,313,098 F822L possibly damaging Het
Dnajb12 A G 10: 59,896,377 Y346C probably damaging Het
Erbb3 A G 10: 128,571,725 I918T probably benign Het
Fam173b T C 15: 31,602,151 probably null Het
Fam58b T C 11: 78,751,331 E111G probably benign Het
Fbxw20 G T 9: 109,221,709 T377K possibly damaging Het
Fry A G 5: 150,370,227 I462V probably damaging Het
Gmip A G 8: 69,813,903 N251S probably benign Het
Gpx1 A G 9: 108,339,475 T55A possibly damaging Het
Hmcn2 T C 2: 31,450,844 V4443A possibly damaging Het
Kdm4d A T 9: 14,464,511 I17K probably benign Het
Lamc3 A G 2: 31,921,781 S927G probably null Het
Mfsd13a C A 19: 46,372,076 H356N probably benign Het
Mtap C T 4: 89,176,914 R268C probably benign Het
Myo1a C T 10: 127,719,334 probably null Het
Myom3 T C 4: 135,775,551 L313P probably benign Het
Nrxn2 T A 19: 6,519,268 V1391E probably damaging Het
Otoa A C 7: 121,091,551 Q3P probably damaging Het
Phldb1 T C 9: 44,715,420 E576G probably damaging Het
Pigw A C 11: 84,877,066 L479R probably damaging Het
Pip5k1a A G 3: 95,063,730 I507T probably benign Het
Ppp4r3b T A 11: 29,188,123 I157N probably benign Het
Rrm2b G A 15: 37,927,322 R115* probably null Het
Sall1 C T 8: 89,028,400 S1317N probably benign Het
Serpinb6b T G 13: 32,974,995 F179V probably damaging Het
Slc4a8 T A 15: 100,800,573 F648I probably damaging Het
Slc5a7 T C 17: 54,281,726 T298A probably damaging Het
Slit3 T C 11: 35,659,344 L830P probably damaging Het
Smarcc1 T A 9: 110,174,004 N387K possibly damaging Het
Tanc2 C T 11: 105,857,500 T486I probably benign Het
Tdp1 C T 12: 99,955,001 P599S probably damaging Het
Tmem33 A G 5: 67,268,554 D38G probably null Het
Uvrag C T 7: 99,004,663 R247Q probably benign Het
Vars T C 17: 35,013,725 V875A probably damaging Het
Vcl A G 14: 21,024,182 E879G probably damaging Het
Vmn1r231 C T 17: 20,890,609 V15I probably benign Het
Zfp609 T C 9: 65,795,311 T20A probably damaging Het
Zfp959 T A 17: 55,898,299 H445Q probably damaging Het
Zmiz2 T A 11: 6,400,795 V515E probably damaging Het
Zmym5 G A 14: 56,804,193 T151M probably damaging Het
Zxdc C T 6: 90,378,951 Q481* probably null Het
Other mutations in Map7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Map7d1 APN 4 126238605 missense probably damaging 1.00
IGL02298:Map7d1 APN 4 126233921 missense unknown
R0136:Map7d1 UTSW 4 126236631 critical splice donor site probably null
R0362:Map7d1 UTSW 4 126234994 missense probably damaging 1.00
R1138:Map7d1 UTSW 4 126242119 missense possibly damaging 0.82
R1499:Map7d1 UTSW 4 126234765 critical splice donor site probably null
R3805:Map7d1 UTSW 4 126237291 splice site probably null
R4369:Map7d1 UTSW 4 126235073 missense probably damaging 0.99
R4814:Map7d1 UTSW 4 126234321 critical splice donor site probably null
R4893:Map7d1 UTSW 4 126233222 missense unknown
R4898:Map7d1 UTSW 4 126233225 missense unknown
R4911:Map7d1 UTSW 4 126236691 missense probably damaging 1.00
R4949:Map7d1 UTSW 4 126235053 nonsense probably null
R5189:Map7d1 UTSW 4 126242304 unclassified probably null
R6198:Map7d1 UTSW 4 126241843 missense probably damaging 1.00
R6336:Map7d1 UTSW 4 126236682 missense probably damaging 1.00
R6558:Map7d1 UTSW 4 126232909 missense unknown
R6781:Map7d1 UTSW 4 126240751 frame shift probably null
R7177:Map7d1 UTSW 4 126236985 missense probably damaging 1.00
R7204:Map7d1 UTSW 4 126256015 critical splice donor site probably null
R7269:Map7d1 UTSW 4 126232873 missense unknown
R7486:Map7d1 UTSW 4 126234386 missense unknown
R7560:Map7d1 UTSW 4 126236636 missense probably damaging 1.00
Z1177:Map7d1 UTSW 4 126234377 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGACAGAGGTCACACACCTTGC -3'
(R):5'- AATGAATGAATCCACTGGACAGGGC -3'

Sequencing Primer
(F):5'- ACACCTTGCTTGGCAGGAG -3'
(R):5'- CAGATTGCTGTGTGAACTGAC -3'
Posted On2014-05-14