Incidental Mutation 'R1692:Gmip'
ID191863
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene NameGem-interacting protein
Synonyms5031419I10Rik
MMRRC Submission 039725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1692 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69808679-69821870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69813903 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 251 (N251S)
Ref Sequence ENSEMBL: ENSMUSP00000116542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036074] [ENSMUST00000123453]
Predicted Effect probably benign
Transcript: ENSMUST00000036074
AA Change: N251S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: N251S

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123453
AA Change: N251S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: N251S

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138269
Predicted Effect probably benign
Transcript: ENSMUST00000142659
SMART Domains Protein: ENSMUSP00000114525
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
Blast:RhoGAP 2 25 1e-7 BLAST
SCOP:d1f7ca_ 3 32 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156620
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam12 A T 7: 133,887,944 *582R probably null Het
Agfg2 A G 5: 137,664,371 Y145H probably damaging Het
Aldh1a1 C T 19: 20,630,818 P335S probably damaging Het
Amotl1 T C 9: 14,551,722 R732G possibly damaging Het
Ankef1 A T 2: 136,550,426 I512F probably benign Het
Atg9a A T 1: 75,190,355 D17E probably benign Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cd79a T A 7: 24,901,456 M192K probably damaging Het
Clcn1 T G 6: 42,313,098 F822L possibly damaging Het
Dnajb12 A G 10: 59,896,377 Y346C probably damaging Het
Erbb3 A G 10: 128,571,725 I918T probably benign Het
Fam173b T C 15: 31,602,151 probably null Het
Fam58b T C 11: 78,751,331 E111G probably benign Het
Fbxw20 G T 9: 109,221,709 T377K possibly damaging Het
Fry A G 5: 150,370,227 I462V probably damaging Het
Gpx1 A G 9: 108,339,475 T55A possibly damaging Het
Hmcn2 T C 2: 31,450,844 V4443A possibly damaging Het
Kdm4d A T 9: 14,464,511 I17K probably benign Het
Lamc3 A G 2: 31,921,781 S927G probably null Het
Map7d1 G A 4: 126,242,308 P36S probably damaging Het
Mfsd13a C A 19: 46,372,076 H356N probably benign Het
Mtap C T 4: 89,176,914 R268C probably benign Het
Myo1a C T 10: 127,719,334 probably null Het
Myom3 T C 4: 135,775,551 L313P probably benign Het
Nrxn2 T A 19: 6,519,268 V1391E probably damaging Het
Otoa A C 7: 121,091,551 Q3P probably damaging Het
Phldb1 T C 9: 44,715,420 E576G probably damaging Het
Pigw A C 11: 84,877,066 L479R probably damaging Het
Pip5k1a A G 3: 95,063,730 I507T probably benign Het
Ppp4r3b T A 11: 29,188,123 I157N probably benign Het
Rrm2b G A 15: 37,927,322 R115* probably null Het
Sall1 C T 8: 89,028,400 S1317N probably benign Het
Serpinb6b T G 13: 32,974,995 F179V probably damaging Het
Slc4a8 T A 15: 100,800,573 F648I probably damaging Het
Slc5a7 T C 17: 54,281,726 T298A probably damaging Het
Slit3 T C 11: 35,659,344 L830P probably damaging Het
Smarcc1 T A 9: 110,174,004 N387K possibly damaging Het
Tanc2 C T 11: 105,857,500 T486I probably benign Het
Tdp1 C T 12: 99,955,001 P599S probably damaging Het
Tmem33 A G 5: 67,268,554 D38G probably null Het
Uvrag C T 7: 99,004,663 R247Q probably benign Het
Vars T C 17: 35,013,725 V875A probably damaging Het
Vcl A G 14: 21,024,182 E879G probably damaging Het
Vmn1r231 C T 17: 20,890,609 V15I probably benign Het
Zfp609 T C 9: 65,795,311 T20A probably damaging Het
Zfp959 T A 17: 55,898,299 H445Q probably damaging Het
Zmiz2 T A 11: 6,400,795 V515E probably damaging Het
Zmym5 G A 14: 56,804,193 T151M probably damaging Het
Zxdc C T 6: 90,378,951 Q481* probably null Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 69817011 nonsense probably null
IGL02529:Gmip APN 8 69816789 missense probably damaging 0.99
IGL03185:Gmip APN 8 69809783 missense probably benign 0.02
IGL03328:Gmip APN 8 69811611 missense possibly damaging 0.79
microdot UTSW 8 69814135 missense probably damaging 1.00
minnox UTSW 8 69817802 missense probably benign 0.02
puncta UTSW 8 69816086 missense possibly damaging 0.50
R0110:Gmip UTSW 8 69815609 unclassified probably benign
R0329:Gmip UTSW 8 69810818 missense probably benign 0.06
R0330:Gmip UTSW 8 69810818 missense probably benign 0.06
R0510:Gmip UTSW 8 69815609 unclassified probably benign
R0638:Gmip UTSW 8 69811445 splice site probably benign
R1721:Gmip UTSW 8 69811232 missense probably damaging 0.96
R1755:Gmip UTSW 8 69814124 missense probably damaging 1.00
R1801:Gmip UTSW 8 69814477 missense probably benign
R1894:Gmip UTSW 8 69820972 missense probably damaging 1.00
R1926:Gmip UTSW 8 69815520 missense probably benign 0.41
R2005:Gmip UTSW 8 69814043 missense probably benign
R4280:Gmip UTSW 8 69813601 unclassified probably benign
R4281:Gmip UTSW 8 69813601 unclassified probably benign
R4282:Gmip UTSW 8 69813601 unclassified probably benign
R4283:Gmip UTSW 8 69813601 unclassified probably benign
R5221:Gmip UTSW 8 69814135 missense probably damaging 1.00
R5512:Gmip UTSW 8 69817890 missense probably benign 0.00
R5521:Gmip UTSW 8 69817399 missense probably damaging 1.00
R5763:Gmip UTSW 8 69817851 missense probably damaging 1.00
R6151:Gmip UTSW 8 69817085 missense probably damaging 1.00
R6163:Gmip UTSW 8 69817372 missense probably benign 0.28
R6228:Gmip UTSW 8 69816123 missense probably damaging 1.00
R6775:Gmip UTSW 8 69815635 missense possibly damaging 0.82
R6787:Gmip UTSW 8 69813786 missense probably damaging 1.00
R6788:Gmip UTSW 8 69811174 missense possibly damaging 0.87
R6788:Gmip UTSW 8 69811176 missense probably damaging 1.00
R6852:Gmip UTSW 8 69817991 nonsense probably null
R6934:Gmip UTSW 8 69820926 missense probably benign
R7010:Gmip UTSW 8 69811400 missense probably damaging 1.00
R7122:Gmip UTSW 8 69817802 missense probably benign 0.02
R7254:Gmip UTSW 8 69816468 splice site probably null
R7351:Gmip UTSW 8 69817384 missense probably benign 0.01
R7360:Gmip UTSW 8 69811242 missense probably damaging 1.00
R7412:Gmip UTSW 8 69820499 missense probably benign
R7577:Gmip UTSW 8 69814435 missense probably benign 0.17
R7718:Gmip UTSW 8 69817733 missense probably damaging 0.99
R8018:Gmip UTSW 8 69815493 missense probably benign 0.41
R8080:Gmip UTSW 8 69816086 missense possibly damaging 0.50
X0063:Gmip UTSW 8 69809816 missense probably damaging 1.00
Z1176:Gmip UTSW 8 69816292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGCTTATGGTCCTCTTGCTGC -3'
(R):5'- GGCTGGTGCCTAAGGACAATGAAAC -3'

Sequencing Primer
(F):5'- TTGCTGCCTCCAAGAATGAG -3'
(R):5'- ATGTGACACTATCCGCCG -3'
Posted On2014-05-14