Incidental Mutation 'R1692:Erbb3'
ID191878
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
MMRRC Submission 039725-MU
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1692 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128571725 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 918 (I918T)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
Predicted Effect probably benign
Transcript: ENSMUST00000082059
AA Change: I918T

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: I918T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam12 A T 7: 133,887,944 *582R probably null Het
Agfg2 A G 5: 137,664,371 Y145H probably damaging Het
Aldh1a1 C T 19: 20,630,818 P335S probably damaging Het
Amotl1 T C 9: 14,551,722 R732G possibly damaging Het
Ankef1 A T 2: 136,550,426 I512F probably benign Het
Atg9a A T 1: 75,190,355 D17E probably benign Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cd79a T A 7: 24,901,456 M192K probably damaging Het
Clcn1 T G 6: 42,313,098 F822L possibly damaging Het
Dnajb12 A G 10: 59,896,377 Y346C probably damaging Het
Fam173b T C 15: 31,602,151 probably null Het
Fam58b T C 11: 78,751,331 E111G probably benign Het
Fbxw20 G T 9: 109,221,709 T377K possibly damaging Het
Fry A G 5: 150,370,227 I462V probably damaging Het
Gmip A G 8: 69,813,903 N251S probably benign Het
Gpx1 A G 9: 108,339,475 T55A possibly damaging Het
Hmcn2 T C 2: 31,450,844 V4443A possibly damaging Het
Kdm4d A T 9: 14,464,511 I17K probably benign Het
Lamc3 A G 2: 31,921,781 S927G probably null Het
Map7d1 G A 4: 126,242,308 P36S probably damaging Het
Mfsd13a C A 19: 46,372,076 H356N probably benign Het
Mtap C T 4: 89,176,914 R268C probably benign Het
Myo1a C T 10: 127,719,334 probably null Het
Myom3 T C 4: 135,775,551 L313P probably benign Het
Nrxn2 T A 19: 6,519,268 V1391E probably damaging Het
Otoa A C 7: 121,091,551 Q3P probably damaging Het
Phldb1 T C 9: 44,715,420 E576G probably damaging Het
Pigw A C 11: 84,877,066 L479R probably damaging Het
Pip5k1a A G 3: 95,063,730 I507T probably benign Het
Ppp4r3b T A 11: 29,188,123 I157N probably benign Het
Rrm2b G A 15: 37,927,322 R115* probably null Het
Sall1 C T 8: 89,028,400 S1317N probably benign Het
Serpinb6b T G 13: 32,974,995 F179V probably damaging Het
Slc4a8 T A 15: 100,800,573 F648I probably damaging Het
Slc5a7 T C 17: 54,281,726 T298A probably damaging Het
Slit3 T C 11: 35,659,344 L830P probably damaging Het
Smarcc1 T A 9: 110,174,004 N387K possibly damaging Het
Tanc2 C T 11: 105,857,500 T486I probably benign Het
Tdp1 C T 12: 99,955,001 P599S probably damaging Het
Tmem33 A G 5: 67,268,554 D38G probably null Het
Uvrag C T 7: 99,004,663 R247Q probably benign Het
Vars T C 17: 35,013,725 V875A probably damaging Het
Vcl A G 14: 21,024,182 E879G probably damaging Het
Vmn1r231 C T 17: 20,890,609 V15I probably benign Het
Zfp609 T C 9: 65,795,311 T20A probably damaging Het
Zfp959 T A 17: 55,898,299 H445Q probably damaging Het
Zmiz2 T A 11: 6,400,795 V515E probably damaging Het
Zmym5 G A 14: 56,804,193 T151M probably damaging Het
Zxdc C T 6: 90,378,951 Q481* probably null Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R7930:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCATCCTGGTAAACTCATTGG -3'
(R):5'- CGGTAAGCACCCCTTTGTCATCAC -3'

Sequencing Primer
(F):5'- AATATTCTCGTCAATCATCCAACC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2014-05-14