Incidental Mutation 'R1692:Tanc2'
ID191885
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission 039725-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1692 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105857500 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 486 (T486I)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect probably benign
Transcript: ENSMUST00000100330
AA Change: T486I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: T486I

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam12 A T 7: 133,887,944 *582R probably null Het
Agfg2 A G 5: 137,664,371 Y145H probably damaging Het
Aldh1a1 C T 19: 20,630,818 P335S probably damaging Het
Amotl1 T C 9: 14,551,722 R732G possibly damaging Het
Ankef1 A T 2: 136,550,426 I512F probably benign Het
Atg9a A T 1: 75,190,355 D17E probably benign Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cd79a T A 7: 24,901,456 M192K probably damaging Het
Clcn1 T G 6: 42,313,098 F822L possibly damaging Het
Dnajb12 A G 10: 59,896,377 Y346C probably damaging Het
Erbb3 A G 10: 128,571,725 I918T probably benign Het
Fam173b T C 15: 31,602,151 probably null Het
Fam58b T C 11: 78,751,331 E111G probably benign Het
Fbxw20 G T 9: 109,221,709 T377K possibly damaging Het
Fry A G 5: 150,370,227 I462V probably damaging Het
Gmip A G 8: 69,813,903 N251S probably benign Het
Gpx1 A G 9: 108,339,475 T55A possibly damaging Het
Hmcn2 T C 2: 31,450,844 V4443A possibly damaging Het
Kdm4d A T 9: 14,464,511 I17K probably benign Het
Lamc3 A G 2: 31,921,781 S927G probably null Het
Map7d1 G A 4: 126,242,308 P36S probably damaging Het
Mfsd13a C A 19: 46,372,076 H356N probably benign Het
Mtap C T 4: 89,176,914 R268C probably benign Het
Myo1a C T 10: 127,719,334 probably null Het
Myom3 T C 4: 135,775,551 L313P probably benign Het
Nrxn2 T A 19: 6,519,268 V1391E probably damaging Het
Otoa A C 7: 121,091,551 Q3P probably damaging Het
Phldb1 T C 9: 44,715,420 E576G probably damaging Het
Pigw A C 11: 84,877,066 L479R probably damaging Het
Pip5k1a A G 3: 95,063,730 I507T probably benign Het
Ppp4r3b T A 11: 29,188,123 I157N probably benign Het
Rrm2b G A 15: 37,927,322 R115* probably null Het
Sall1 C T 8: 89,028,400 S1317N probably benign Het
Serpinb6b T G 13: 32,974,995 F179V probably damaging Het
Slc4a8 T A 15: 100,800,573 F648I probably damaging Het
Slc5a7 T C 17: 54,281,726 T298A probably damaging Het
Slit3 T C 11: 35,659,344 L830P probably damaging Het
Smarcc1 T A 9: 110,174,004 N387K possibly damaging Het
Tdp1 C T 12: 99,955,001 P599S probably damaging Het
Tmem33 A G 5: 67,268,554 D38G probably null Het
Uvrag C T 7: 99,004,663 R247Q probably benign Het
Vars T C 17: 35,013,725 V875A probably damaging Het
Vcl A G 14: 21,024,182 E879G probably damaging Het
Vmn1r231 C T 17: 20,890,609 V15I probably benign Het
Zfp609 T C 9: 65,795,311 T20A probably damaging Het
Zfp959 T A 17: 55,898,299 H445Q probably damaging Het
Zmiz2 T A 11: 6,400,795 V515E probably damaging Het
Zmym5 G A 14: 56,804,193 T151M probably damaging Het
Zxdc C T 6: 90,378,951 Q481* probably null Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 splice site probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
R7878:Tanc2 UTSW 11 105913415 missense
R7895:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
R7952:Tanc2 UTSW 11 105896597 missense probably damaging 1.00
R8099:Tanc2 UTSW 11 105864007 missense probably benign 0.17
R8117:Tanc2 UTSW 11 105835162 missense probably damaging 1.00
R8133:Tanc2 UTSW 11 105923222 missense probably damaging 0.97
R8422:Tanc2 UTSW 11 105835188 missense probably benign 0.10
R8527:Tanc2 UTSW 11 105917008 missense probably damaging 0.96
R8542:Tanc2 UTSW 11 105917008 missense probably damaging 0.96
R8834:Tanc2 UTSW 11 105917019 missense
R8912:Tanc2 UTSW 11 105867327 missense probably benign 0.01
R8928:Tanc2 UTSW 11 105810505 missense probably damaging 0.99
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CATACAATCGAGAAGGCGTAGCCC -3'
(R):5'- AGTGACCACGGCTCTTTTCAACC -3'

Sequencing Primer
(F):5'- ACCAAAGACAGTGTTAGGGTATG -3'
(R):5'- ACGGCTCTTTTCAACCTTATTTATAC -3'
Posted On2014-05-14