Incidental Mutation 'R1693:Lrp4'
ID191910
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Namelow density lipoprotein receptor-related protein 4
Synonymsmdig, Megf7
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91457511-91513779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91492353 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1096 (Y1096H)
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
Predicted Effect probably damaging
Transcript: ENSMUST00000028689
AA Change: Y1096H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: Y1096H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Meta Mutation Damage Score 0.9025 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91495026 missense probably benign
IGL00509:Lrp4 APN 2 91486174 splice site probably benign
IGL01145:Lrp4 APN 2 91487051 missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91473948 missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91511553 missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91473641 missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91477551 missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91481981 critical splice donor site probably null
IGL01885:Lrp4 APN 2 91501107 missense probably benign 0.05
IGL01909:Lrp4 APN 2 91494184 missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91506059 missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91474720 missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91508582 missense probably benign 0.05
IGL02431:Lrp4 APN 2 91476637 missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91474002 missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91476710 missense probably benign 0.02
IGL02828:Lrp4 APN 2 91475294 missense probably benign
IGL02832:Lrp4 APN 2 91511580 missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91474816 missense possibly damaging 0.76
F5770:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0137:Lrp4 UTSW 2 91494982 missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91490670 missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91477734 missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91475178 splice site probably benign
R0827:Lrp4 UTSW 2 91495041 missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91487027 splice site probably benign
R1183:Lrp4 UTSW 2 91477519 critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91476305 missense probably benign 0.26
R1747:Lrp4 UTSW 2 91492621 missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91498363 missense probably benign 0.15
R1908:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1909:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91497355 nonsense probably null
R1934:Lrp4 UTSW 2 91480432 missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R2433:Lrp4 UTSW 2 91506015 missense probably benign 0.00
R2698:Lrp4 UTSW 2 91475212 missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91490730 missense probably benign 0.01
R3105:Lrp4 UTSW 2 91501049 missense probably benign
R3709:Lrp4 UTSW 2 91490466 missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R3735:Lrp4 UTSW 2 91498371 missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91476702 missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91511670 missense probably benign 0.20
R4741:Lrp4 UTSW 2 91511567 missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91485886 missense probably benign
R5050:Lrp4 UTSW 2 91492422 missense probably benign 0.22
R5096:Lrp4 UTSW 2 91485792 missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91497072 missense possibly damaging 0.48
R5141:Lrp4 UTSW 2 91478678 splice site probably benign
R5439:Lrp4 UTSW 2 91497073 missense probably benign 0.14
R5725:Lrp4 UTSW 2 91494895 missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91474471 missense probably benign 0.01
R5820:Lrp4 UTSW 2 91492615 missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91488433 missense probably benign 0.01
R5919:Lrp4 UTSW 2 91473207 missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91511684 missense probably benign 0.01
R6080:Lrp4 UTSW 2 91502000 missense probably benign
R6189:Lrp4 UTSW 2 91475234 missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91508488 missense probably benign 0.00
R6319:Lrp4 UTSW 2 91480321 missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91493829 missense probably benign 0.18
R6479:Lrp4 UTSW 2 91487084 missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91492420 missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91501995 missense probably benign
R6657:Lrp4 UTSW 2 91492053 missense probably benign 0.00
R6696:Lrp4 UTSW 2 91497345 missense probably benign 0.03
R6714:Lrp4 UTSW 2 91476365 missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91485897 missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91497303 missense probably benign 0.33
R6774:Lrp4 UTSW 2 91511504 missense probably benign 0.01
R6957:Lrp4 UTSW 2 91487042 missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91491998 missense probably damaging 1.00
R7065:Lrp4 UTSW 2 91511580 missense probably damaging 1.00
R7142:Lrp4 UTSW 2 91494994 missense probably damaging 0.99
R7219:Lrp4 UTSW 2 91492023 missense probably damaging 1.00
R7237:Lrp4 UTSW 2 91473183 missense probably benign 0.04
R7387:Lrp4 UTSW 2 91476614 missense probably benign
R7585:Lrp4 UTSW 2 91492588 missense probably damaging 1.00
R7835:Lrp4 UTSW 2 91495042 missense possibly damaging 0.82
R7872:Lrp4 UTSW 2 91490716 missense possibly damaging 0.54
R7968:Lrp4 UTSW 2 91494079 missense possibly damaging 0.74
R8222:Lrp4 UTSW 2 91474741 missense probably damaging 1.00
R8338:Lrp4 UTSW 2 91492368 missense probably benign 0.15
R8342:Lrp4 UTSW 2 91488445 missense probably damaging 1.00
R8435:Lrp4 UTSW 2 91477653 missense probably damaging 1.00
R8720:Lrp4 UTSW 2 91494114 missense probably damaging 1.00
R8774:Lrp4 UTSW 2 91477698 missense probably benign 0.09
R8774-TAIL:Lrp4 UTSW 2 91477698 missense probably benign 0.09
R8792:Lrp4 UTSW 2 91494955 missense possibly damaging 0.71
R8913:Lrp4 UTSW 2 91501440 missense probably benign 0.11
V7580:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7581:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91501062 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCTGATCAAAAGCCATCAGTGTCC -3'
(R):5'- GAGTGATAAAGCCAGCTCTCACCC -3'

Sequencing Primer
(F):5'- AAAAGCCATCAGTGTCCTTTCTTC -3'
(R):5'- CATGGTATAATACAATGGCCCG -3'
Posted On2014-05-14