Incidental Mutation 'R1693:Chrm5'
ID191912
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Namecholinergic receptor, muscarinic 5
SynonymsM5R, muscarinic acetylcholine receptor 5
MMRRC Submission 039726-MU
Accession Numbers

Genbank: NM_205783; MGI: 109248

Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112479171-112480769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112479280 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 497 (L497P)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
Predicted Effect probably damaging
Transcript: ENSMUST00000099589
AA Change: L497P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: L497P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Meta Mutation Damage Score 0.8747 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112479232 missense probably benign
IGL01611:Chrm5 APN 2 112480306 nonsense probably null
IGL02152:Chrm5 APN 2 112480568 missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112480361 missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112480211 missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112480720 missense probably benign
R0432:Chrm5 UTSW 2 112479655 missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112479869 missense probably benign 0.00
R1611:Chrm5 UTSW 2 112479187 missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112479837 missense probably benign 0.00
R1988:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112479227 missense probably null 0.93
R2890:Chrm5 UTSW 2 112479703 missense probably benign 0.00
R4659:Chrm5 UTSW 2 112479757 missense probably benign
R4785:Chrm5 UTSW 2 112479585 missense probably benign 0.25
R5196:Chrm5 UTSW 2 112480384 missense probably damaging 1.00
R5734:Chrm5 UTSW 2 112480100 missense probably benign 0.28
R6343:Chrm5 UTSW 2 112479448 missense probably damaging 1.00
R6499:Chrm5 UTSW 2 112480480 missense probably benign
R6672:Chrm5 UTSW 2 112479796 missense probably benign
R6905:Chrm5 UTSW 2 112479556 missense probably benign 0.00
R7192:Chrm5 UTSW 2 112480327 missense probably damaging 0.97
R7775:Chrm5 UTSW 2 112479956 missense probably benign 0.07
R7778:Chrm5 UTSW 2 112479956 missense probably benign 0.07
R8780:Chrm5 UTSW 2 112480108 missense possibly damaging 0.64
X0023:Chrm5 UTSW 2 112480481 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACCTTGCACCTTGACAAGCC -3'
(R):5'- GTTCCTTCCCAGTGTCCAAAGACC -3'

Sequencing Primer
(F):5'- TTGACAAGCCTTCAGGGACTC -3'
(R):5'- ACGAAAGAGAATGGTCCTAGTC -3'
Posted On2014-05-14