Incidental Mutation 'R1693:Cep152'
ID191913
Institutional Source Beutler Lab
Gene Symbol Cep152
Ensembl Gene ENSMUSG00000068394
Gene Namecentrosomal protein 152
Synonyms
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125563088-125625113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 125566254 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1390 (A1390S)
Ref Sequence ENSEMBL: ENSMUSP00000087208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089776]
Predicted Effect probably benign
Transcript: ENSMUST00000089776
AA Change: A1390S

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087208
Gene: ENSMUSG00000068394
AA Change: A1390S

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
coiled coil region 228 481 N/A INTRINSIC
low complexity region 582 593 N/A INTRINSIC
coiled coil region 602 651 N/A INTRINSIC
coiled coil region 692 770 N/A INTRINSIC
low complexity region 780 793 N/A INTRINSIC
coiled coil region 835 868 N/A INTRINSIC
coiled coil region 954 1038 N/A INTRINSIC
coiled coil region 1205 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Embryos homozygous for a null allele exhibit reduced numbers of centrosomes and cilia, increased apoptosis, and midgestation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Cep152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cep152 APN 2 125563888 missense probably benign 0.01
IGL00561:Cep152 APN 2 125563723 nonsense probably null
IGL01082:Cep152 APN 2 125569545 splice site probably benign
IGL01420:Cep152 APN 2 125563652 missense possibly damaging 0.49
IGL01832:Cep152 APN 2 125618494 nonsense probably null
IGL02106:Cep152 APN 2 125602936 splice site probably null
IGL02124:Cep152 APN 2 125563461 missense probably benign 0.23
IGL02349:Cep152 APN 2 125594956 missense probably damaging 0.99
IGL02541:Cep152 APN 2 125605354 missense probably damaging 1.00
IGL02659:Cep152 APN 2 125579549 missense probably damaging 0.96
IGL02711:Cep152 APN 2 125563942 missense possibly damaging 0.93
IGL02737:Cep152 APN 2 125586474 missense possibly damaging 0.71
IGL03060:Cep152 APN 2 125619987 splice site probably benign
IGL03095:Cep152 APN 2 125618451 missense probably benign 0.00
IGL03186:Cep152 APN 2 125563975 missense probably benign
IGL03306:Cep152 APN 2 125605408 missense possibly damaging 0.90
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0079:Cep152 UTSW 2 125618453 missense possibly damaging 0.92
R0244:Cep152 UTSW 2 125564214 missense probably benign 0.00
R0390:Cep152 UTSW 2 125576869 splice site probably benign
R0462:Cep152 UTSW 2 125583934 missense possibly damaging 0.64
R0480:Cep152 UTSW 2 125581719 missense possibly damaging 0.95
R0595:Cep152 UTSW 2 125595063 missense probably damaging 0.99
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R1634:Cep152 UTSW 2 125583889 missense probably benign 0.00
R1664:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1887:Cep152 UTSW 2 125620305 missense probably benign 0.00
R1930:Cep152 UTSW 2 125618371 critical splice donor site probably null
R2178:Cep152 UTSW 2 125580034 splice site probably null
R2225:Cep152 UTSW 2 125581784 missense probably damaging 1.00
R2324:Cep152 UTSW 2 125563462 missense probably benign 0.38
R2416:Cep152 UTSW 2 125564172 nonsense probably null
R2845:Cep152 UTSW 2 125587974 missense probably damaging 1.00
R3753:Cep152 UTSW 2 125625052 unclassified probably benign
R4212:Cep152 UTSW 2 125620001 missense probably benign 0.00
R4304:Cep152 UTSW 2 125563723 nonsense probably null
R4371:Cep152 UTSW 2 125613047 missense probably damaging 1.00
R4399:Cep152 UTSW 2 125587980 missense possibly damaging 0.63
R4536:Cep152 UTSW 2 125602947 splice site probably null
R4713:Cep152 UTSW 2 125587948 missense possibly damaging 0.79
R4777:Cep152 UTSW 2 125564095 missense probably benign 0.29
R4779:Cep152 UTSW 2 125568892 missense possibly damaging 0.52
R4785:Cep152 UTSW 2 125586329 critical splice donor site probably null
R4816:Cep152 UTSW 2 125563754 missense probably damaging 1.00
R4847:Cep152 UTSW 2 125618474 missense possibly damaging 0.62
R4898:Cep152 UTSW 2 125586381 missense probably benign 0.03
R4934:Cep152 UTSW 2 125611096 missense possibly damaging 0.52
R4997:Cep152 UTSW 2 125586351 missense probably benign 0.00
R5068:Cep152 UTSW 2 125571816 missense probably benign 0.25
R5183:Cep152 UTSW 2 125566638 missense probably damaging 1.00
R5198:Cep152 UTSW 2 125587624 missense probably benign
R5261:Cep152 UTSW 2 125564205 missense probably benign 0.06
R5272:Cep152 UTSW 2 125611030 missense probably benign 0.27
R5284:Cep152 UTSW 2 125580021 missense probably damaging 1.00
R6029:Cep152 UTSW 2 125563632 missense probably benign 0.44
R6155:Cep152 UTSW 2 125581700 missense probably benign
R6239:Cep152 UTSW 2 125579412 missense probably benign 0.40
R6590:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6690:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6754:Cep152 UTSW 2 125587668 missense probably damaging 0.99
R6798:Cep152 UTSW 2 125566527 splice site probably null
R6816:Cep152 UTSW 2 125595027 missense probably damaging 1.00
R6977:Cep152 UTSW 2 125568822 critical splice donor site probably null
R7125:Cep152 UTSW 2 125566673 nonsense probably null
R7146:Cep152 UTSW 2 125614405 missense probably benign 0.06
R7588:Cep152 UTSW 2 125569626 missense probably damaging 1.00
R7852:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7883:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R7935:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7966:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R8047:Cep152 UTSW 2 125564327 missense probably benign 0.10
X0009:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0010:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0011:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0014:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0017:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0021:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0022:Cep152 UTSW 2 125620063 missense probably benign 0.07
X0023:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0028:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0033:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0064:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0067:Cep152 UTSW 2 125614386 missense probably damaging 1.00
Z1176:Cep152 UTSW 2 125583971 missense probably benign 0.23
Z1177:Cep152 UTSW 2 125614324 missense probably benign 0.33
Z1177:Cep152 UTSW 2 125619704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACCTGGATAGTTTGGAGCCG -3'
(R):5'- ACTGGTCTGAAGTTTTCCCTGCTG -3'

Sequencing Primer
(F):5'- CCTAAGTTTCTGGTCAAAACCC -3'
(R):5'- ACCTGAGTTGTCTTCAGCAG -3'
Posted On2014-05-14