Incidental Mutation 'R1693:Cd53'
ID191915
Institutional Source Beutler Lab
Gene Symbol Cd53
Ensembl Gene ENSMUSG00000040747
Gene NameCD53 antigen
SynonymsTspan25, Ox-44
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location106759921-106790149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106768889 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 54 (N54S)
Ref Sequence ENSEMBL: ENSMUSP00000035781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038845
AA Change: N54S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035781
Gene: ENSMUSG00000040747
AA Change: N54S

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 210 4.6e-54 PFAM
Meta Mutation Damage Score 0.6726 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: B cells lacking this gene exhibit impaired PKC recruitment to the plasma membrane and phosphorylation of PKC substrates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Cd53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Cd53 APN 3 106768826 missense probably damaging 1.00
IGL02592:Cd53 APN 3 106763285 missense probably damaging 1.00
R0090:Cd53 UTSW 3 106767409 missense possibly damaging 0.94
R0392:Cd53 UTSW 3 106763276 missense probably damaging 1.00
R0538:Cd53 UTSW 3 106762128 missense probably benign 0.07
R1452:Cd53 UTSW 3 106768959 missense probably damaging 1.00
R2042:Cd53 UTSW 3 106767424 critical splice acceptor site probably null
R2300:Cd53 UTSW 3 106763256 missense probably benign
R2878:Cd53 UTSW 3 106767416 missense probably benign 0.00
R4081:Cd53 UTSW 3 106762145 missense probably benign
R6180:Cd53 UTSW 3 106767364 missense probably damaging 0.96
R6519:Cd53 UTSW 3 106762145 missense probably benign 0.00
R6694:Cd53 UTSW 3 106767386 missense probably benign 0.03
R7043:Cd53 UTSW 3 106763261 missense probably damaging 1.00
R7417:Cd53 UTSW 3 106768919 missense probably benign 0.17
R7736:Cd53 UTSW 3 106767936 missense probably benign 0.12
R7893:Cd53 UTSW 3 106767386 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTCTTGATTGTAGGTGTTTCCCAAA -3'
(R):5'- GAGTCTTGAGTCAGCAAAACCAGGTAA -3'

Sequencing Primer
(F):5'- TGCTACAATGACTCACCGAC -3'
(R):5'- CCAGGTAACACTGATCTCAAGAAGG -3'
Posted On2014-05-14