Incidental Mutation 'R1693:Chd7'
ID191917
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Namechromodomain helicase DNA binding protein 7
SynonymsA730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
MMRRC Submission 039726-MU
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location8690406-8867659 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 8864307 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
Predicted Effect probably null
Transcript: ENSMUST00000039267
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051558
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Meta Mutation Damage Score 0.584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8828398 missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0388:Chd7 UTSW 4 8854560 missense probably benign 0.27
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0799:Chd7 UTSW 4 8801310 intron probably benign
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1605:Chd7 UTSW 4 8844675 missense probably damaging 1.00
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2134:Chd7 UTSW 4 8753147 missense probably damaging 0.99
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8844417 missense probably damaging 1.00
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
R7288:Chd7 UTSW 4 8847093 missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8752196 missense unknown
R7452:Chd7 UTSW 4 8854731 missense probably benign 0.03
R7471:Chd7 UTSW 4 8859197 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGGGAAACGTCCATGATGTTCAG -3'
(R):5'- TCTTAACGTTCCCATCCAGCACAAG -3'

Sequencing Primer
(F):5'- TCAGTTGTTCACCGGATGC -3'
(R):5'- TAAGTCCACCTCTAAGAGGGTTG -3'
Posted On2014-05-14