Incidental Mutation 'R1693:Rad52'
ID191925
Institutional Source Beutler Lab
Gene Symbol Rad52
Ensembl Gene ENSMUSG00000030166
Gene NameRAD52 homolog, DNA repair protein
Synonyms
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119902698-119922828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119916035 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 180 (P180Q)
Ref Sequence ENSEMBL: ENSMUSP00000125502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032269] [ENSMUST00000161045] [ENSMUST00000162461]
Predicted Effect probably damaging
Transcript: ENSMUST00000032269
AA Change: P180Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032269
Gene: ENSMUSG00000030166
AA Change: P180Q

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 185 2.4e-56 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160877
Predicted Effect probably benign
Transcript: ENSMUST00000161045
SMART Domains Protein: ENSMUSP00000125559
Gene: ENSMUSG00000030166

DomainStartEndE-ValueType
PDB:1H2I|V 1 64 2e-26 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162255
Predicted Effect probably damaging
Transcript: ENSMUST00000162461
AA Change: P180Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125502
Gene: ENSMUSG00000030166
AA Change: P180Q

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 36 184 6.6e-51 PFAM
low complexity region 262 276 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204319
Meta Mutation Damage Score 0.2099 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit normal reproductive and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Rad52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Rad52 APN 6 119918633 missense probably damaging 1.00
IGL02376:Rad52 APN 6 119915230 splice site probably benign
IGL02572:Rad52 APN 6 119915227 splice site probably benign
IGL03292:Rad52 APN 6 119918973 missense possibly damaging 0.96
R2076:Rad52 UTSW 6 119911079 missense probably benign 0.39
R2110:Rad52 UTSW 6 119920894 missense possibly damaging 0.80
R4753:Rad52 UTSW 6 119912985 intron probably benign
R5857:Rad52 UTSW 6 119911007 splice site probably null
R5866:Rad52 UTSW 6 119912946 intron probably benign
R6193:Rad52 UTSW 6 119920182 missense probably benign 0.03
R6369:Rad52 UTSW 6 119914207 missense unknown
R8886:Rad52 UTSW 6 119913080 missense probably damaging 0.99
R8888:Rad52 UTSW 6 119913080 missense probably damaging 0.99
R8889:Rad52 UTSW 6 119913080 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCTCAGAGCTAGTAGAGTGCAG -3'
(R):5'- TGTCCATGAGATGCAATGGAAAGCC -3'

Sequencing Primer
(F):5'- TTACCCAATGAATGAAGGTTAGGGTC -3'
(R):5'- TGCTGCCAAACACTGAGT -3'
Posted On2014-05-14