Mutagenetix > Incidental Mutations

Incidental Mutation 'R1693:Vps33b'

191930

Institutional Source

Beutler Lab

Gene Symbol

Vps33b

Ensembl Gene

ENSMUSG00000030534

Gene Name

vacuolar protein sorting 33B

Synonyms

MMRRC Submission

039726-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1693 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

80269649-80291754 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80287893 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 463 (V463E)

Ref Sequence

ENSEMBL: ENSMUSP00000032749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032749] [ENSMUST00000135053] [ENSMUST00000150585]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032749
AA Change: V463E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534
AA Change: V463E

Domain	Start	End	E-Value	Type
Pfam:Sec1	37	611	2.4e-89	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128254

Predicted Effect

probably benign
Transcript: ENSMUST00000135053

SMART Domains

Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

Domain	Start	End	E-Value	Type
SCOP:d1epua_	18	59	2e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145594

Predicted Effect

probably benign
Transcript: ENSMUST00000150585

SMART Domains

Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534

Domain	Start	End	E-Value	Type
Pfam:Sec1	36	140	1.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205864

Meta Mutation Damage Score

0.1711

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.2%
20x: 92.2%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C vacuolar protein sorting proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Mutations in this gene are associated with arthrogryposis-renal dysfunction-cholestasis syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry scaly skin, hair loss, thrombocytosis, abnormal alpha-granule development, extramedullary hematopoiesis, abnormal platelets and megakaryocytes, and defects in tail tendon collagen I structure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff4	A	G	11: 53,396,553	D378G	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Aox1	T	C	1: 58,085,542	Y981H	probably damaging	Het
Arfgap2	T	A	2: 91,270,075		probably null	Het
Ccnf	TGGGGG	TGGGGGGG	17: 24,226,540		probably null	Het
Cd53	T	C	3: 106,768,889	N54S	possibly damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd7	T	C	4: 8,864,307		probably null	Het
Chrm5	A	G	2: 112,479,280	L497P	probably damaging	Het
Colec12	G	A	18: 9,866,765	V659M	unknown	Het
Creb3	C	A	4: 43,566,755	H390Q	probably damaging	Het
D1Pas1	T	C	1: 186,968,029	F52L	probably benign	Het
D5Ertd579e	A	G	5: 36,614,097	F985L	probably damaging	Het
Dock4	C	T	12: 40,834,722	P1742S	probably benign	Het
Ehmt2	G	T	17: 34,906,410	V534L	possibly damaging	Het
Epcam	A	G	17: 87,639,896	D26G	probably benign	Het
F2	C	T	2: 91,629,179	V420M	probably damaging	Het
Fbxw16	A	T	9: 109,436,259	D401E	possibly damaging	Het
Fiz1	T	C	7: 5,008,728	T264A	probably benign	Het
Fsbp	T	C	4: 11,583,745	V148A	probably benign	Het
Furin	A	G	7: 80,392,482	L455P	probably damaging	Het
Ggt7	G	A	2: 155,506,475	R10W	probably damaging	Het
Gucy2g	T	C	19: 55,222,926	E624G	probably damaging	Het
Igf2r	A	G	17: 12,704,316	F1202S	probably damaging	Het
Ikzf1	C	T	11: 11,707,838	P32S	probably damaging	Het
Itgal	G	A	7: 127,305,281	V309M	probably damaging	Het
Kcnk5	C	A	14: 20,141,896	R399L	probably damaging	Het
Kdm5b	C	T	1: 134,597,576		probably benign	Het
Lrp2	C	T	2: 69,510,418	V1038M	probably damaging	Het
Lrp4	T	C	2: 91,492,353	Y1096H	probably damaging	Het
Lrrc7	C	G	3: 158,084,533	S1465T	possibly damaging	Het
Maats1	A	G	16: 38,341,723	Y19H	probably benign	Het
Map3k5	A	G	10: 20,104,242	N832S	probably damaging	Het
Mkl2	C	A	16: 13,398,470	L349I	possibly damaging	Het
Mkl2	T	A	16: 13,398,471	L349Q	probably damaging	Het
Myh13	A	C	11: 67,341,484	M495L	possibly damaging	Het
Myh9	A	C	15: 77,812,897	Y106D	probably damaging	Het
Naa16	A	T	14: 79,351,456	W452R	probably damaging	Het
Nsd1	T	C	13: 55,247,261	S892P	probably benign	Het
Nup205	A	G	6: 35,210,971	I939V	probably benign	Het
Oit3	A	G	10: 59,425,417	F476S	probably damaging	Het
Olfr868	T	C	9: 20,101,587	V276A	probably benign	Het
Panx3	A	T	9: 37,668,907	M50K	possibly damaging	Het
Panx3	A	C	9: 37,668,946	M37R	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkaca	T	A	8: 83,981,198	D37E	probably benign	Het
Prkcq	T	A	2: 11,254,199	I310N	probably damaging	Het
Prrc2c	A	G	1: 162,718,713	Y235H	probably damaging	Het
Ptprj	A	T	2: 90,449,797	C1052*	probably null	Het
Rad52	C	A	6: 119,916,035	P180Q	probably damaging	Het
Sdhaf3	T	A	6: 7,038,964	D95E	probably benign	Het
Slitrk6	A	G	14: 110,750,928	I449T	probably damaging	Het
Spata7	T	A	12: 98,664,257	M358K	possibly damaging	Het
Tada2a	C	T	11: 84,082,069	G178D	probably damaging	Het
Tap2	G	C	17: 34,209,212	V287L	probably benign	Het
Tmem200a	A	G	10: 25,993,979	F131L	possibly damaging	Het
Tmem55a	T	A	4: 14,886,631	D68E	probably benign	Het
Traip	A	T	9: 107,970,030	K356M	probably damaging	Het
Tspan8	T	A	10: 115,844,044		probably benign	Het
U2surp	A	T	9: 95,511,860	M1K	probably null	Het
Vars	A	T	17: 34,998,196	D427E	probably benign	Het
Vmn1r113	G	A	7: 20,787,607	C108Y	probably damaging	Het
Vmn2r63	T	A	7: 42,928,319	Q265L	probably benign	Het
Vrtn	T	C	12: 84,648,655	S60P	probably benign	Het
Zfp53	T	A	17: 21,509,622	V639D	possibly damaging	Het
Zfp964	T	A	8: 69,664,150	S466T	possibly damaging	Het

Other mutations in Vps33b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Vps33b	APN	7	80285843	missense	probably damaging	1.00
IGL01352:Vps33b	APN	7	80285059	unclassified	probably null
IGL01863:Vps33b	APN	7	80274311	critical splice donor site	probably null
IGL01918:Vps33b	APN	7	80287812	unclassified	probably null
IGL02152:Vps33b	APN	7	80285069	missense	probably benign	0.29
IGL02364:Vps33b	APN	7	80287839	missense	probably damaging	1.00
IGL02383:Vps33b	APN	7	80285334	unclassified	probably null
IGL02669:Vps33b	APN	7	80276038	splice site	probably benign
IGL03104:Vps33b	APN	7	80276083	missense	probably damaging	1.00
IGL03333:Vps33b	APN	7	80274225	splice site	probably benign
PIT4651001:Vps33b	UTSW	7	80290007	missense	probably damaging	0.99
R0267:Vps33b	UTSW	7	80286054	missense	possibly damaging	0.87
R0379:Vps33b	UTSW	7	80283414	splice site	probably null
R0971:Vps33b	UTSW	7	80287899	missense	possibly damaging	0.75
R1184:Vps33b	UTSW	7	80282486	missense	probably benign	0.02
R1639:Vps33b	UTSW	7	80284353	missense	probably damaging	1.00
R4502:Vps33b	UTSW	7	80287907	missense	possibly damaging	0.94
R4609:Vps33b	UTSW	7	80291118	missense	probably benign	0.00
R4748:Vps33b	UTSW	7	80290048	missense	probably damaging	1.00
R5083:Vps33b	UTSW	7	80274641	missense	probably damaging	0.99
R5304:Vps33b	UTSW	7	80274253	missense	probably damaging	1.00
R5774:Vps33b	UTSW	7	80285340	missense	probably benign	0.38
R5991:Vps33b	UTSW	7	80283414	splice site	probably null
R7085:Vps33b	UTSW	7	80276089	missense	probably benign	0.12
R7409:Vps33b	UTSW	7	80285269	missense	probably damaging	0.97
X0018:Vps33b	UTSW	7	80290565	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTTGATACTGCCACTCACGAGAGC -3'
(R):5'- TCAATGCAGTGCAGGCATCAGC -3'

Sequencing Primer
(F):5'- CAGAGTGCGTGTGACTTCC -3'
(R):5'- aaggaaagcaagggaaacaac -3'

Posted On

2014-05-14