Incidental Mutation 'R1693:Vps33b'
ID191930
Institutional Source Beutler Lab
Gene Symbol Vps33b
Ensembl Gene ENSMUSG00000030534
Gene Namevacuolar protein sorting 33B
Synonyms
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1693 (G1)
Quality Score177
Status Validated
Chromosome7
Chromosomal Location80269649-80291754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80287893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 463 (V463E)
Ref Sequence ENSEMBL: ENSMUSP00000032749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032749] [ENSMUST00000135053] [ENSMUST00000150585]
Predicted Effect probably damaging
Transcript: ENSMUST00000032749
AA Change: V463E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534
AA Change: V463E

DomainStartEndE-ValueType
Pfam:Sec1 37 611 2.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128254
Predicted Effect probably benign
Transcript: ENSMUST00000135053
SMART Domains Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
SCOP:d1epua_ 18 59 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145594
Predicted Effect probably benign
Transcript: ENSMUST00000150585
SMART Domains Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 36 140 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205864
Meta Mutation Damage Score 0.1711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C vacuolar protein sorting proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Mutations in this gene are associated with arthrogryposis-renal dysfunction-cholestasis syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry scaly skin, hair loss, thrombocytosis, abnormal alpha-granule development, extramedullary hematopoiesis, abnormal platelets and megakaryocytes, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Vps33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Vps33b APN 7 80285843 missense probably damaging 1.00
IGL01352:Vps33b APN 7 80285059 unclassified probably null
IGL01863:Vps33b APN 7 80274311 critical splice donor site probably null
IGL01918:Vps33b APN 7 80287812 unclassified probably null
IGL02152:Vps33b APN 7 80285069 missense probably benign 0.29
IGL02364:Vps33b APN 7 80287839 missense probably damaging 1.00
IGL02383:Vps33b APN 7 80285334 unclassified probably null
IGL02669:Vps33b APN 7 80276038 splice site probably benign
IGL03104:Vps33b APN 7 80276083 missense probably damaging 1.00
IGL03333:Vps33b APN 7 80274225 splice site probably benign
PIT4651001:Vps33b UTSW 7 80290007 missense probably damaging 0.99
R0267:Vps33b UTSW 7 80286054 missense possibly damaging 0.87
R0379:Vps33b UTSW 7 80283414 splice site probably null
R0971:Vps33b UTSW 7 80287899 missense possibly damaging 0.75
R1184:Vps33b UTSW 7 80282486 missense probably benign 0.02
R1639:Vps33b UTSW 7 80284353 missense probably damaging 1.00
R4502:Vps33b UTSW 7 80287907 missense possibly damaging 0.94
R4609:Vps33b UTSW 7 80291118 missense probably benign 0.00
R4748:Vps33b UTSW 7 80290048 missense probably damaging 1.00
R5083:Vps33b UTSW 7 80274641 missense probably damaging 0.99
R5304:Vps33b UTSW 7 80274253 missense probably damaging 1.00
R5774:Vps33b UTSW 7 80285340 missense probably benign 0.38
R5991:Vps33b UTSW 7 80283414 splice site probably null
R7085:Vps33b UTSW 7 80276089 missense probably benign 0.12
R7409:Vps33b UTSW 7 80285269 missense probably damaging 0.97
X0018:Vps33b UTSW 7 80290565 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGATACTGCCACTCACGAGAGC -3'
(R):5'- TCAATGCAGTGCAGGCATCAGC -3'

Sequencing Primer
(F):5'- CAGAGTGCGTGTGACTTCC -3'
(R):5'- aaggaaagcaagggaaacaac -3'
Posted On2014-05-14