Incidental Mutation 'R1693:Tada2a'
Institutional Source Beutler Lab
Gene Symbol Tada2a
Ensembl Gene ENSMUSG00000018651
Gene Nametranscriptional adaptor 2A
SynonymsTada2l, D030022J10Rik
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosomal Location84078920-84129600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84082069 bp
Amino Acid Change Glycine to Aspartic acid at position 178 (G178D)
Ref Sequence ENSEMBL: ENSMUSP00000119022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018795] [ENSMUST00000141852]
Predicted Effect probably damaging
Transcript: ENSMUST00000018795
AA Change: G372D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018795
Gene: ENSMUSG00000018651
AA Change: G372D

Blast:ZnF_ZZ 11 57 2e-25 BLAST
SANT 71 120 3.1e-10 SMART
low complexity region 134 143 N/A INTRINSIC
Pfam:SWIRM 364 441 5.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134994
Predicted Effect probably damaging
Transcript: ENSMUST00000141852
AA Change: G178D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119022
Gene: ENSMUSG00000018651
AA Change: G178D

Pfam:SWIRM 168 235 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156151
Meta Mutation Damage Score 0.3033 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Tada2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Tada2a APN 11 84087192 splice site probably benign
PIT4131001:Tada2a UTSW 11 84079737 missense probably damaging 0.98
R1438:Tada2a UTSW 11 84110011 missense probably damaging 0.99
R1615:Tada2a UTSW 11 84103100 missense probably damaging 1.00
R1688:Tada2a UTSW 11 84084759 critical splice acceptor site probably null
R2146:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R2147:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R2150:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R3980:Tada2a UTSW 11 84103120 missense probably benign 0.41
R5364:Tada2a UTSW 11 84121147 missense probably benign
R5686:Tada2a UTSW 11 84079602 missense possibly damaging 0.59
R7117:Tada2a UTSW 11 84085688 missense probably damaging 0.99
R7439:Tada2a UTSW 11 84126986 critical splice donor site probably null
Z1177:Tada2a UTSW 11 84093667 start codon destroyed probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccacacctcctaatctttccc -3'
Posted On2014-05-14