Mutagenetix > Incidental Mutations

Incidental Mutation 'R1693:Kcnk5'

191957

Institutional Source

Beutler Lab

Gene Symbol

Kcnk5

Ensembl Gene

ENSMUSG00000023243

Gene Name

potassium channel, subfamily K, member 5

Synonyms

TASK-2

MMRRC Submission

039726-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R1693 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20140057-20181809 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 20141896 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 399 (R399L)

Ref Sequence

ENSEMBL: ENSMUSP00000024011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024011]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024011
AA Change: R399L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024011
Gene: ENSMUSG00000023243
AA Change: R399L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans_2	60	138	7.1e-20	PFAM
Pfam:Ion_trans_2	161	251	2.1e-13	PFAM
low complexity region	257	264	N/A	INTRINSIC
low complexity region	317	330	N/A	INTRINSIC
low complexity region	469	483	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225552

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226090

Meta Mutation Damage Score

0.1206

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.2%
20x: 92.2%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The message for this gene is mainly expressed in the cortical distal tubules and collecting ducts of the kidney. The protein is highly sensitive to external pH and this, in combination with its expression pattern, suggests it may play an important role in renal potassium transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are smaller than normal and display varying amounts of prenatal lethality depending on genetic background. Otherwise, the mice are viable and fertile. Other targeted mice display aberrations in respiratory physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff4	A	G	11: 53,396,553	D378G	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Aox1	T	C	1: 58,085,542	Y981H	probably damaging	Het
Arfgap2	T	A	2: 91,270,075		probably null	Het
Ccnf	TGGGGG	TGGGGGGG	17: 24,226,540		probably null	Het
Cd53	T	C	3: 106,768,889	N54S	possibly damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd7	T	C	4: 8,864,307		probably null	Het
Chrm5	A	G	2: 112,479,280	L497P	probably damaging	Het
Colec12	G	A	18: 9,866,765	V659M	unknown	Het
Creb3	C	A	4: 43,566,755	H390Q	probably damaging	Het
D1Pas1	T	C	1: 186,968,029	F52L	probably benign	Het
D5Ertd579e	A	G	5: 36,614,097	F985L	probably damaging	Het
Dock4	C	T	12: 40,834,722	P1742S	probably benign	Het
Ehmt2	G	T	17: 34,906,410	V534L	possibly damaging	Het
Epcam	A	G	17: 87,639,896	D26G	probably benign	Het
F2	C	T	2: 91,629,179	V420M	probably damaging	Het
Fbxw16	A	T	9: 109,436,259	D401E	possibly damaging	Het
Fiz1	T	C	7: 5,008,728	T264A	probably benign	Het
Fsbp	T	C	4: 11,583,745	V148A	probably benign	Het
Furin	A	G	7: 80,392,482	L455P	probably damaging	Het
Ggt7	G	A	2: 155,506,475	R10W	probably damaging	Het
Gucy2g	T	C	19: 55,222,926	E624G	probably damaging	Het
Igf2r	A	G	17: 12,704,316	F1202S	probably damaging	Het
Ikzf1	C	T	11: 11,707,838	P32S	probably damaging	Het
Itgal	G	A	7: 127,305,281	V309M	probably damaging	Het
Kdm5b	C	T	1: 134,597,576		probably benign	Het
Lrp2	C	T	2: 69,510,418	V1038M	probably damaging	Het
Lrp4	T	C	2: 91,492,353	Y1096H	probably damaging	Het
Lrrc7	C	G	3: 158,084,533	S1465T	possibly damaging	Het
Maats1	A	G	16: 38,341,723	Y19H	probably benign	Het
Map3k5	A	G	10: 20,104,242	N832S	probably damaging	Het
Mkl2	C	A	16: 13,398,470	L349I	possibly damaging	Het
Mkl2	T	A	16: 13,398,471	L349Q	probably damaging	Het
Myh13	A	C	11: 67,341,484	M495L	possibly damaging	Het
Myh9	A	C	15: 77,812,897	Y106D	probably damaging	Het
Naa16	A	T	14: 79,351,456	W452R	probably damaging	Het
Nsd1	T	C	13: 55,247,261	S892P	probably benign	Het
Nup205	A	G	6: 35,210,971	I939V	probably benign	Het
Oit3	A	G	10: 59,425,417	F476S	probably damaging	Het
Olfr868	T	C	9: 20,101,587	V276A	probably benign	Het
Panx3	A	T	9: 37,668,907	M50K	possibly damaging	Het
Panx3	A	C	9: 37,668,946	M37R	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkaca	T	A	8: 83,981,198	D37E	probably benign	Het
Prkcq	T	A	2: 11,254,199	I310N	probably damaging	Het
Prrc2c	A	G	1: 162,718,713	Y235H	probably damaging	Het
Ptprj	A	T	2: 90,449,797	C1052*	probably null	Het
Rad52	C	A	6: 119,916,035	P180Q	probably damaging	Het
Sdhaf3	T	A	6: 7,038,964	D95E	probably benign	Het
Slitrk6	A	G	14: 110,750,928	I449T	probably damaging	Het
Spata7	T	A	12: 98,664,257	M358K	possibly damaging	Het
Tada2a	C	T	11: 84,082,069	G178D	probably damaging	Het
Tap2	G	C	17: 34,209,212	V287L	probably benign	Het
Tmem200a	A	G	10: 25,993,979	F131L	possibly damaging	Het
Tmem55a	T	A	4: 14,886,631	D68E	probably benign	Het
Traip	A	T	9: 107,970,030	K356M	probably damaging	Het
Tspan8	T	A	10: 115,844,044		probably benign	Het
U2surp	A	T	9: 95,511,860	M1K	probably null	Het
Vars	A	T	17: 34,998,196	D427E	probably benign	Het
Vmn1r113	G	A	7: 20,787,607	C108Y	probably damaging	Het
Vmn2r63	T	A	7: 42,928,319	Q265L	probably benign	Het
Vps33b	T	A	7: 80,287,893	V463E	probably damaging	Het
Vrtn	T	C	12: 84,648,655	S60P	probably benign	Het
Zfp53	T	A	17: 21,509,622	V639D	possibly damaging	Het
Zfp964	T	A	8: 69,664,150	S466T	possibly damaging	Het

Other mutations in Kcnk5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02555:Kcnk5	APN	14	20141985	missense	probably benign	0.27
IGL02672:Kcnk5	APN	14	20146512	missense	probably damaging	1.00
IGL02716:Kcnk5	APN	14	20181428	missense	probably damaging	1.00
IGL03253:Kcnk5	APN	14	20142337	missense	probably benign	0.21
R1553:Kcnk5	UTSW	14	20142394	missense	probably damaging	1.00
R1742:Kcnk5	UTSW	14	20141857	missense	probably benign	0.00
R2051:Kcnk5	UTSW	14	20142209	missense	probably damaging	1.00
R2415:Kcnk5	UTSW	14	20141812	missense	possibly damaging	0.61
R4230:Kcnk5	UTSW	14	20144784	missense	probably damaging	1.00
R6637:Kcnk5	UTSW	14	20144721	missense	probably null	1.00
R6877:Kcnk5	UTSW	14	20144716	missense	possibly damaging	0.69
R7552:Kcnk5	UTSW	14	20142281	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- AATTCACCCGTGCTGCTCAAGG -3'
(R):5'- GCTGGAAGTACAGCATCCAAGGAC -3'

Sequencing Primer
(F):5'- GTTGTCCTCCACAGAAGACT -3'
(R):5'- TCTTCAGCTTCCTATCCAAAAAGG -3'

Posted On

2014-05-14