Incidental Mutation 'R1693:Kcnk5'
ID191957
Institutional Source Beutler Lab
Gene Symbol Kcnk5
Ensembl Gene ENSMUSG00000023243
Gene Namepotassium channel, subfamily K, member 5
SynonymsTASK-2
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20140057-20181809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20141896 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 399 (R399L)
Ref Sequence ENSEMBL: ENSMUSP00000024011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024011]
Predicted Effect probably damaging
Transcript: ENSMUST00000024011
AA Change: R399L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024011
Gene: ENSMUSG00000023243
AA Change: R399L

DomainStartEndE-ValueType
Pfam:Ion_trans_2 60 138 7.1e-20 PFAM
Pfam:Ion_trans_2 161 251 2.1e-13 PFAM
low complexity region 257 264 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 469 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226090
Meta Mutation Damage Score 0.1206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The message for this gene is mainly expressed in the cortical distal tubules and collecting ducts of the kidney. The protein is highly sensitive to external pH and this, in combination with its expression pattern, suggests it may play an important role in renal potassium transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are smaller than normal and display varying amounts of prenatal lethality depending on genetic background. Otherwise, the mice are viable and fertile. Other targeted mice display aberrations in respiratory physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Kcnk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02555:Kcnk5 APN 14 20141985 missense probably benign 0.27
IGL02672:Kcnk5 APN 14 20146512 missense probably damaging 1.00
IGL02716:Kcnk5 APN 14 20181428 missense probably damaging 1.00
IGL03253:Kcnk5 APN 14 20142337 missense probably benign 0.21
R1553:Kcnk5 UTSW 14 20142394 missense probably damaging 1.00
R1742:Kcnk5 UTSW 14 20141857 missense probably benign 0.00
R2051:Kcnk5 UTSW 14 20142209 missense probably damaging 1.00
R2415:Kcnk5 UTSW 14 20141812 missense possibly damaging 0.61
R4230:Kcnk5 UTSW 14 20144784 missense probably damaging 1.00
R6637:Kcnk5 UTSW 14 20144721 missense probably null 1.00
R6877:Kcnk5 UTSW 14 20144716 missense possibly damaging 0.69
R7552:Kcnk5 UTSW 14 20142281 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AATTCACCCGTGCTGCTCAAGG -3'
(R):5'- GCTGGAAGTACAGCATCCAAGGAC -3'

Sequencing Primer
(F):5'- GTTGTCCTCCACAGAAGACT -3'
(R):5'- TCTTCAGCTTCCTATCCAAAAAGG -3'
Posted On2014-05-14