Mutagenetix > Incidental Mutation

Incidental Mutation 'R1693:Naa16'

191958

Institutional Source

Beutler Lab

Gene Symbol

Naa16

Ensembl Gene

ENSMUSG00000022020

Gene Name

N(alpha)-acetyltransferase 16, NatA auxiliary subunit

Synonyms

Narg1l, 1300019C06Rik

MMRRC Submission

039726-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R1693 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79325269-79390778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79351456 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 452 (W452R)

Ref Sequence

ENSEMBL: ENSMUSP00000131268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486]

AlphaFold

Q9DBB4

Predicted Effect

probably damaging
Transcript: ENSMUST00000022597
AA Change: W486R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: W486R

Domain	Start	End	E-Value	Type
TPR	46	79	2.99e1	SMART
TPR	80	113	2.98e-3	SMART
Blast:TPR	224	257	1e-10	BLAST
TPR	374	407	9.96e0	SMART
TPR	408	441	7.47e0	SMART
low complexity region	616	633	N/A	INTRINSIC
Blast:TPR	672	705	3e-12	BLAST
low complexity region	830	841	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163486
AA Change: W452R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020
AA Change: W452R

Domain	Start	End	E-Value	Type
TPR	12	45	2.99e1	SMART
TPR	46	79	2.98e-3	SMART
Blast:TPR	190	223	3e-10	BLAST
TPR	340	373	9.96e0	SMART
TPR	374	407	7.47e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227775

Meta Mutation Damage Score

0.9374

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.2%
20x: 92.2%

Validation Efficiency

96% (69/72)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff4	A	G	11: 53,396,553	D378G	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Aox1	T	C	1: 58,085,542	Y981H	probably damaging	Het
Arfgap2	T	A	2: 91,270,075		probably null	Het
Ccnf	TGGGGG	TGGGGGGG	17: 24,226,540		probably null	Het
Cd53	T	C	3: 106,768,889	N54S	possibly damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd7	T	C	4: 8,864,307		probably null	Het
Chrm5	A	G	2: 112,479,280	L497P	probably damaging	Het
Colec12	G	A	18: 9,866,765	V659M	unknown	Het
Creb3	C	A	4: 43,566,755	H390Q	probably damaging	Het
D1Pas1	T	C	1: 186,968,029	F52L	probably benign	Het
D5Ertd579e	A	G	5: 36,614,097	F985L	probably damaging	Het
Dock4	C	T	12: 40,834,722	P1742S	probably benign	Het
Ehmt2	G	T	17: 34,906,410	V534L	possibly damaging	Het
Epcam	A	G	17: 87,639,896	D26G	probably benign	Het
F2	C	T	2: 91,629,179	V420M	probably damaging	Het
Fbxw16	A	T	9: 109,436,259	D401E	possibly damaging	Het
Fiz1	T	C	7: 5,008,728	T264A	probably benign	Het
Fsbp	T	C	4: 11,583,745	V148A	probably benign	Het
Furin	A	G	7: 80,392,482	L455P	probably damaging	Het
Ggt7	G	A	2: 155,506,475	R10W	probably damaging	Het
Gucy2g	T	C	19: 55,222,926	E624G	probably damaging	Het
Igf2r	A	G	17: 12,704,316	F1202S	probably damaging	Het
Ikzf1	C	T	11: 11,707,838	P32S	probably damaging	Het
Itgal	G	A	7: 127,305,281	V309M	probably damaging	Het
Kcnk5	C	A	14: 20,141,896	R399L	probably damaging	Het
Kdm5b	C	T	1: 134,597,576		probably benign	Het
Lrp2	C	T	2: 69,510,418	V1038M	probably damaging	Het
Lrp4	T	C	2: 91,492,353	Y1096H	probably damaging	Het
Lrrc7	C	G	3: 158,084,533	S1465T	possibly damaging	Het
Maats1	A	G	16: 38,341,723	Y19H	probably benign	Het
Map3k5	A	G	10: 20,104,242	N832S	probably damaging	Het
Mkl2	C	A	16: 13,398,470	L349I	possibly damaging	Het
Mkl2	T	A	16: 13,398,471	L349Q	probably damaging	Het
Myh13	A	C	11: 67,341,484	M495L	possibly damaging	Het
Myh9	A	C	15: 77,812,897	Y106D	probably damaging	Het
Nsd1	T	C	13: 55,247,261	S892P	probably benign	Het
Nup205	A	G	6: 35,210,971	I939V	probably benign	Het
Oit3	A	G	10: 59,425,417	F476S	probably damaging	Het
Olfr868	T	C	9: 20,101,587	V276A	probably benign	Het
Panx3	A	T	9: 37,668,907	M50K	possibly damaging	Het
Panx3	A	C	9: 37,668,946	M37R	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkaca	T	A	8: 83,981,198	D37E	probably benign	Het
Prkcq	T	A	2: 11,254,199	I310N	probably damaging	Het
Prrc2c	A	G	1: 162,718,713	Y235H	probably damaging	Het
Ptprj	A	T	2: 90,449,797	C1052*	probably null	Het
Rad52	C	A	6: 119,916,035	P180Q	probably damaging	Het
Sdhaf3	T	A	6: 7,038,964	D95E	probably benign	Het
Slitrk6	A	G	14: 110,750,928	I449T	probably damaging	Het
Spata7	T	A	12: 98,664,257	M358K	possibly damaging	Het
Tada2a	C	T	11: 84,082,069	G178D	probably damaging	Het
Tap2	G	C	17: 34,209,212	V287L	probably benign	Het
Tmem200a	A	G	10: 25,993,979	F131L	possibly damaging	Het
Tmem55a	T	A	4: 14,886,631	D68E	probably benign	Het
Traip	A	T	9: 107,970,030	K356M	probably damaging	Het
Tspan8	T	A	10: 115,844,044		probably benign	Het
U2surp	A	T	9: 95,511,860	M1K	probably null	Het
Vars	A	T	17: 34,998,196	D427E	probably benign	Het
Vmn1r113	G	A	7: 20,787,607	C108Y	probably damaging	Het
Vmn2r63	T	A	7: 42,928,319	Q265L	probably benign	Het
Vps33b	T	A	7: 80,287,893	V463E	probably damaging	Het
Vrtn	T	C	12: 84,648,655	S60P	probably benign	Het
Zfp53	T	A	17: 21,509,622	V639D	possibly damaging	Het
Zfp964	T	A	8: 69,664,150	S466T	possibly damaging	Het

Other mutations in Naa16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Naa16	APN	14	79355729	missense	probably damaging	1.00
IGL01025:Naa16	APN	14	79384756	missense	probably damaging	1.00
IGL01155:Naa16	APN	14	79384715	missense	probably damaging	0.98
IGL01335:Naa16	APN	14	79345116	splice site	probably benign
IGL01981:Naa16	APN	14	79381516	missense	probably benign	0.05
IGL02230:Naa16	APN	14	79377361	splice site	probably benign
IGL02313:Naa16	APN	14	79384668	missense	probably damaging	1.00
IGL02418:Naa16	APN	14	79383366	missense	probably damaging	1.00
IGL02544:Naa16	APN	14	79335820	missense	probably damaging	1.00
IGL03051:Naa16	APN	14	79369082	missense	probably benign	0.01
IGL03064:Naa16	APN	14	79339628	missense	probably damaging	0.98
IGL03205:Naa16	APN	14	79356512	missense	possibly damaging	0.89
PIT4508001:Naa16	UTSW	14	79369087	missense	probably benign	0.15
R0651:Naa16	UTSW	14	79351392	missense	probably damaging	1.00
R1429:Naa16	UTSW	14	79359527	missense	probably benign	0.01
R1674:Naa16	UTSW	14	79387057	start codon destroyed	probably null	0.65
R1874:Naa16	UTSW	14	79355743	missense	possibly damaging	0.62
R1992:Naa16	UTSW	14	79356491	missense	probably damaging	1.00
R2015:Naa16	UTSW	14	79345059	missense	probably damaging	1.00
R2391:Naa16	UTSW	14	79370049	missense	probably benign	0.16
R2847:Naa16	UTSW	14	79335883	missense	probably damaging	1.00
R2848:Naa16	UTSW	14	79335883	missense	probably damaging	1.00
R2877:Naa16	UTSW	14	79343298	missense	probably benign	0.00
R3884:Naa16	UTSW	14	79343262	missense	probably damaging	0.98
R4001:Naa16	UTSW	14	79343121	splice site	probably null
R4199:Naa16	UTSW	14	79355871	missense	probably damaging	1.00
R4638:Naa16	UTSW	14	79340033	splice site	probably null
R4676:Naa16	UTSW	14	79336348	unclassified	probably benign
R4690:Naa16	UTSW	14	79345057	missense	probably damaging	1.00
R4952:Naa16	UTSW	14	79345085	missense	probably damaging	1.00
R5087:Naa16	UTSW	14	79377415	missense	possibly damaging	0.68
R5104:Naa16	UTSW	14	79384700	nonsense	probably null
R5729:Naa16	UTSW	14	79355780	missense	probably damaging	1.00
R6178:Naa16	UTSW	14	79383340	missense	possibly damaging	0.93
R6960:Naa16	UTSW	14	79359471	missense	possibly damaging	0.65
R7794:Naa16	UTSW	14	79377494	missense	probably damaging	1.00
R7936:Naa16	UTSW	14	79341046	missense	possibly damaging	0.47
R8356:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8456:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8892:Naa16	UTSW	14	79390576	missense	probably benign	0.32
R8931:Naa16	UTSW	14	79344955	missense	probably damaging	1.00
R9010:Naa16	UTSW	14	79370042	missense	probably benign	0.01
R9068:Naa16	UTSW	14	79374849	missense	probably benign	0.18
R9360:Naa16	UTSW	14	79356503	missense	probably benign	0.05
R9688:Naa16	UTSW	14	79335869	nonsense	probably null
X0064:Naa16	UTSW	14	79351389	missense	probably damaging	1.00
Z1177:Naa16	UTSW	14	79344979	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGAAGCTGTCAGAGTCAGTCAGG -3'
(R):5'- AGCCGAGTAAGTGAGACCACTGTG -3'

Sequencing Primer
(F):5'- TCAGGAGAGGCAGACGATCC -3'
(R):5'- tccttcaaattgtcctctgacc -3'

Posted On

2014-05-14