Incidental Mutation 'R1693:Maats1'
ID191963
Institutional Source Beutler Lab
Gene Symbol Maats1
Ensembl Gene ENSMUSG00000022805
Gene NameMYCBP-associated, testis expressed 1
SynonymsSpata26, 4932425I24Rik
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38297754-38342143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38341723 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 19 (Y19H)
Ref Sequence ENSEMBL: ENSMUSP00000110388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023501] [ENSMUST00000114740]
Predicted Effect probably benign
Transcript: ENSMUST00000023501
AA Change: Y19H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023501
Gene: ENSMUSG00000022805
AA Change: Y19H

DomainStartEndE-ValueType
Pfam:PaaSYMP 190 342 1.4e-65 PFAM
low complexity region 413 428 N/A INTRINSIC
low complexity region 513 526 N/A INTRINSIC
low complexity region 599 613 N/A INTRINSIC
coiled coil region 650 682 N/A INTRINSIC
coiled coil region 737 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114740
AA Change: Y19H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110388
Gene: ENSMUSG00000022805
AA Change: Y19H

DomainStartEndE-ValueType
Pfam:PaaSYMP 189 342 1.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141896
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Maats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Maats1 APN 16 38336342 critical splice donor site probably null
IGL02243:Maats1 APN 16 38341780 utr 5 prime probably benign
IGL02377:Maats1 APN 16 38332819 splice site probably benign
IGL02604:Maats1 APN 16 38321559 unclassified probably benign
IGL02623:Maats1 APN 16 38333778 missense possibly damaging 0.51
IGL02985:Maats1 APN 16 38298272 missense probably damaging 0.98
IGL03389:Maats1 APN 16 38324136 critical splice donor site probably null
PIT4280001:Maats1 UTSW 16 38332773 missense probably benign 0.23
PIT4449001:Maats1 UTSW 16 38328358 missense probably damaging 1.00
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0360:Maats1 UTSW 16 38298297 critical splice acceptor site probably null
R0501:Maats1 UTSW 16 38335635 missense probably damaging 1.00
R0523:Maats1 UTSW 16 38328374 missense probably damaging 1.00
R0743:Maats1 UTSW 16 38335634 missense possibly damaging 0.48
R0900:Maats1 UTSW 16 38336402 missense possibly damaging 0.70
R1218:Maats1 UTSW 16 38298133 missense probably benign
R1499:Maats1 UTSW 16 38321400 missense probably damaging 0.96
R1793:Maats1 UTSW 16 38321419 missense possibly damaging 0.77
R1854:Maats1 UTSW 16 38324297 splice site probably null
R2007:Maats1 UTSW 16 38298254 missense probably benign 0.02
R2126:Maats1 UTSW 16 38341762 missense probably benign 0.19
R2443:Maats1 UTSW 16 38302732 missense probably damaging 1.00
R2857:Maats1 UTSW 16 38302713 missense probably damaging 1.00
R2937:Maats1 UTSW 16 38311038 missense possibly damaging 0.65
R3441:Maats1 UTSW 16 38333806 missense probably benign 0.03
R3442:Maats1 UTSW 16 38333806 missense probably benign 0.03
R4056:Maats1 UTSW 16 38298214 missense probably benign
R4057:Maats1 UTSW 16 38298214 missense probably benign
R4424:Maats1 UTSW 16 38320365 missense probably damaging 1.00
R4493:Maats1 UTSW 16 38341768 missense probably benign 0.00
R4546:Maats1 UTSW 16 38335523 missense probably benign 0.11
R5177:Maats1 UTSW 16 38332321 missense probably benign 0.00
R5496:Maats1 UTSW 16 38321493 missense probably damaging 1.00
R5868:Maats1 UTSW 16 38332242 missense probably damaging 1.00
R5944:Maats1 UTSW 16 38328310 missense probably damaging 0.97
R6165:Maats1 UTSW 16 38333811 missense possibly damaging 0.93
R6521:Maats1 UTSW 16 38306759 missense probably benign 0.06
R6804:Maats1 UTSW 16 38332242 missense probably damaging 0.97
R7086:Maats1 UTSW 16 38306857 missense possibly damaging 0.70
R7202:Maats1 UTSW 16 38335597 missense probably benign 0.00
R7271:Maats1 UTSW 16 38328346 missense probably damaging 1.00
R7325:Maats1 UTSW 16 38321601 splice site probably null
R7375:Maats1 UTSW 16 38335618 missense probably damaging 0.97
R7453:Maats1 UTSW 16 38321479 missense possibly damaging 0.51
R7604:Maats1 UTSW 16 38298236 nonsense probably null
R8040:Maats1 UTSW 16 38320371 missense possibly damaging 0.89
R8702:Maats1 UTSW 16 38332312 missense probably benign 0.00
X0062:Maats1 UTSW 16 38298099 missense possibly damaging 0.70
X0067:Maats1 UTSW 16 38306860 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACTTGGGACTTAGGGCTCCCAC -3'
(R):5'- GGCAGAATCCCTATCCCTTAGCCTC -3'

Sequencing Primer
(F):5'- TTAGGGCTCCCACCTGTG -3'
(R):5'- AGTACCCAGCTCCTCAGGTC -3'
Posted On2014-05-14