Mutagenetix > Incidental Mutation

Incidental Mutation 'R1693:Igf2r'

191964

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

039726-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.875) question?

Stock #

R1693 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12704316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1202 (F1202S)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: F1202S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: F1202S

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Meta Mutation Damage Score

0.9111

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.2%
20x: 92.2%

Validation Efficiency

96% (69/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff4	A	G	11: 53,396,553	D378G	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Aox1	T	C	1: 58,085,542	Y981H	probably damaging	Het
Arfgap2	T	A	2: 91,270,075		probably null	Het
Ccnf	TGGGGG	TGGGGGGG	17: 24,226,540		probably null	Het
Cd53	T	C	3: 106,768,889	N54S	possibly damaging	Het
Cep152	C	A	2: 125,566,254	A1390S	probably benign	Het
Chd7	T	C	4: 8,864,307		probably null	Het
Chrm5	A	G	2: 112,479,280	L497P	probably damaging	Het
Colec12	G	A	18: 9,866,765	V659M	unknown	Het
Creb3	C	A	4: 43,566,755	H390Q	probably damaging	Het
D1Pas1	T	C	1: 186,968,029	F52L	probably benign	Het
D5Ertd579e	A	G	5: 36,614,097	F985L	probably damaging	Het
Dock4	C	T	12: 40,834,722	P1742S	probably benign	Het
Ehmt2	G	T	17: 34,906,410	V534L	possibly damaging	Het
Epcam	A	G	17: 87,639,896	D26G	probably benign	Het
F2	C	T	2: 91,629,179	V420M	probably damaging	Het
Fbxw16	A	T	9: 109,436,259	D401E	possibly damaging	Het
Fiz1	T	C	7: 5,008,728	T264A	probably benign	Het
Fsbp	T	C	4: 11,583,745	V148A	probably benign	Het
Furin	A	G	7: 80,392,482	L455P	probably damaging	Het
Ggt7	G	A	2: 155,506,475	R10W	probably damaging	Het
Gucy2g	T	C	19: 55,222,926	E624G	probably damaging	Het
Ikzf1	C	T	11: 11,707,838	P32S	probably damaging	Het
Itgal	G	A	7: 127,305,281	V309M	probably damaging	Het
Kcnk5	C	A	14: 20,141,896	R399L	probably damaging	Het
Kdm5b	C	T	1: 134,597,576		probably benign	Het
Lrp2	C	T	2: 69,510,418	V1038M	probably damaging	Het
Lrp4	T	C	2: 91,492,353	Y1096H	probably damaging	Het
Lrrc7	C	G	3: 158,084,533	S1465T	possibly damaging	Het
Maats1	A	G	16: 38,341,723	Y19H	probably benign	Het
Map3k5	A	G	10: 20,104,242	N832S	probably damaging	Het
Mkl2	C	A	16: 13,398,470	L349I	possibly damaging	Het
Mkl2	T	A	16: 13,398,471	L349Q	probably damaging	Het
Myh13	A	C	11: 67,341,484	M495L	possibly damaging	Het
Myh9	A	C	15: 77,812,897	Y106D	probably damaging	Het
Naa16	A	T	14: 79,351,456	W452R	probably damaging	Het
Nsd1	T	C	13: 55,247,261	S892P	probably benign	Het
Nup205	A	G	6: 35,210,971	I939V	probably benign	Het
Oit3	A	G	10: 59,425,417	F476S	probably damaging	Het
Olfr868	T	C	9: 20,101,587	V276A	probably benign	Het
Panx3	A	T	9: 37,668,907	M50K	possibly damaging	Het
Panx3	A	C	9: 37,668,946	M37R	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prkaca	T	A	8: 83,981,198	D37E	probably benign	Het
Prkcq	T	A	2: 11,254,199	I310N	probably damaging	Het
Prrc2c	A	G	1: 162,718,713	Y235H	probably damaging	Het
Ptprj	A	T	2: 90,449,797	C1052*	probably null	Het
Rad52	C	A	6: 119,916,035	P180Q	probably damaging	Het
Sdhaf3	T	A	6: 7,038,964	D95E	probably benign	Het
Slitrk6	A	G	14: 110,750,928	I449T	probably damaging	Het
Spata7	T	A	12: 98,664,257	M358K	possibly damaging	Het
Tada2a	C	T	11: 84,082,069	G178D	probably damaging	Het
Tap2	G	C	17: 34,209,212	V287L	probably benign	Het
Tmem200a	A	G	10: 25,993,979	F131L	possibly damaging	Het
Tmem55a	T	A	4: 14,886,631	D68E	probably benign	Het
Traip	A	T	9: 107,970,030	K356M	probably damaging	Het
Tspan8	T	A	10: 115,844,044		probably benign	Het
U2surp	A	T	9: 95,511,860	M1K	probably null	Het
Vars	A	T	17: 34,998,196	D427E	probably benign	Het
Vmn1r113	G	A	7: 20,787,607	C108Y	probably damaging	Het
Vmn2r63	T	A	7: 42,928,319	Q265L	probably benign	Het
Vps33b	T	A	7: 80,287,893	V463E	probably damaging	Het
Vrtn	T	C	12: 84,648,655	S60P	probably benign	Het
Zfp53	T	A	17: 21,509,622	V639D	possibly damaging	Het
Zfp964	T	A	8: 69,664,150	S466T	possibly damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAGCCCATCCTGACTGCTTTACTG -3'
(R):5'- AGCATCCTGTACGTGAATGGGGAC -3'

Sequencing Primer
(F):5'- CAAGTGGCTTAATAAAGACCTCAAG -3'
(R):5'- CAGGAAACGCTTGCTTGG -3'

Posted On

2014-05-14