Incidental Mutation 'R1694:Col4a3'
ID 191978
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Name collagen, type IV, alpha 3
Synonyms alpha3(IV), tumstatin
MMRRC Submission 039727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1694 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 82586921-82722059 bp(+) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 82690663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457]
AlphaFold Q9QZS0
Predicted Effect probably null
Transcript: ENSMUST00000113457
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465

signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181720
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T C 10: 120,778,628 probably benign Het
4930447C04Rik C T 12: 72,885,218 probably null Het
Abca16 A G 7: 120,520,084 H1017R probably damaging Het
Actl11 A G 9: 107,930,008 Y510C probably damaging Het
Agbl2 A G 2: 90,801,320 T341A probably damaging Het
Agbl5 A G 5: 30,893,382 Y458C probably damaging Het
Akap5 C T 12: 76,329,924 S710L probably damaging Het
Akr1c21 A G 13: 4,575,178 E36G probably damaging Het
Arhgap44 A G 11: 65,053,197 S163P probably damaging Het
Armc1 A G 3: 19,134,886 V205A possibly damaging Het
Asph A G 4: 9,610,869 L102P probably damaging Het
Brca1 T C 11: 101,532,099 E74G probably damaging Het
Brms1l A G 12: 55,841,600 R58G probably damaging Het
C1qbp G T 11: 70,978,247 probably null Het
Calcrl A T 2: 84,339,287 L350H probably damaging Het
Casr A T 16: 36,495,591 F706I probably damaging Het
Ceacam10 T A 7: 24,781,066 N87K probably benign Het
Cfap206 G T 4: 34,719,058 T316K probably damaging Het
Comtd1 A G 14: 21,847,330 V183A probably damaging Het
Crygs A T 16: 22,806,675 probably null Het
Dact1 C A 12: 71,312,777 T139K probably damaging Het
Dlx6 T C 6: 6,867,173 W259R probably damaging Het
Dnah9 G T 11: 65,954,824 S627* probably null Het
Dnajc11 T A 4: 151,979,273 V442D probably damaging Het
Dnajc21 A T 15: 10,451,563 S393T probably benign Het
Dpysl3 C A 18: 43,328,374 C584F possibly damaging Het
Efcab14 A G 4: 115,746,539 K138R possibly damaging Het
Ephb3 A G 16: 21,221,745 E577G probably damaging Het
Exoc3 C T 13: 74,190,065 probably null Het
Fam171a1 A G 2: 3,225,623 S473G probably benign Het
Fbxl2 A T 9: 114,003,171 F58L probably damaging Het
Fmo6 T C 1: 162,922,672 M272V probably benign Het
Gm1000 T C 12: 104,476,600 probably benign Het
Gm765 A C 6: 98,238,139 S174R probably damaging Het
Grik1 T A 16: 87,950,068 D442V probably damaging Het
Hectd1 A G 12: 51,744,592 Y2588H probably damaging Het
Insrr A C 3: 87,804,062 T430P probably benign Het
Lats1 T C 10: 7,701,945 S278P probably benign Het
Lrch4 A G 5: 137,638,461 T463A probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Lyst T G 13: 13,661,161 F1809L probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Magoh G T 4: 107,883,165 R82L probably benign Het
Mlh1 A G 9: 111,228,475 V756A probably damaging Het
Mlh3 T C 12: 85,267,141 E757G probably damaging Het
Mycbp2 T C 14: 103,227,511 T1339A probably damaging Het
Myh7b A T 2: 155,613,193 E46V probably damaging Het
Naalad2 T A 9: 18,327,387 R677S probably damaging Het
Nadsyn1 G A 7: 143,808,012 T324I probably benign Het
Neo1 A T 9: 58,880,603 L1389Q probably damaging Het
Nlrp1b A G 11: 71,216,855 probably null Het
Nup210 A C 6: 91,062,803 I690S probably benign Het
Olfr235 T A 19: 12,268,917 I229N probably damaging Het
Olfr543 A T 7: 102,477,340 S177T probably benign Het
Olfr824 T A 10: 130,126,254 I268F possibly damaging Het
Otud7a C A 7: 63,733,710 H316N probably damaging Het
Pcdh15 T C 10: 74,594,163 S1241P probably damaging Het
Pclo A G 5: 14,520,963 K121E probably damaging Het
Pcmtd1 A T 1: 7,147,648 I107L probably benign Het
Pde6c A G 19: 38,180,225 I755V probably damaging Het
Pi4ka A T 16: 17,295,376 I1532N probably damaging Het
Pla2r1 A G 2: 60,441,084 probably null Het
Plb1 A G 5: 32,317,277 N661S probably null Het
Plekhd1 A G 12: 80,722,321 K452E possibly damaging Het
Prr12 C A 7: 45,028,579 V2003F unknown Het
Ptger1 G A 8: 83,668,478 G195R probably benign Het
Ptpn4 T C 1: 119,783,510 Q67R probably damaging Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rock1 A G 18: 10,136,094 probably null Het
Rtn1 T C 12: 72,223,524 Y71C probably damaging Het
Rtp4 T C 16: 23,613,120 *62Q probably null Het
Scimp G T 11: 70,793,792 P78H probably damaging Het
Scn8a C A 15: 100,955,528 S132* probably null Het
Set A G 2: 30,069,424 I124M probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sgce A G 6: 4,689,709 S375P probably damaging Het
Slc4a1ap G C 5: 31,543,754 E600Q probably damaging Het
Slit1 A G 19: 41,637,592 V577A possibly damaging Het
Sqstm1 A G 11: 50,207,480 V153A probably benign Het
Src A G 2: 157,469,755 M468V possibly damaging Het
Srrm3 A G 5: 135,873,225 probably benign Het
Stk11ip C T 1: 75,527,386 R257W probably damaging Het
Tfrc T A 16: 32,614,625 D32E probably damaging Het
Tor1aip2 A T 1: 156,065,285 I446L probably benign Het
Trmt11 T C 10: 30,535,225 H424R probably benign Het
Urb1 A G 16: 90,767,040 Y1612H probably benign Het
Vcan A T 13: 89,688,483 S2981T probably damaging Het
Vdac1 G C 11: 52,374,363 G21A probably damaging Het
Vmn2r76 A G 7: 86,230,148 S315P probably benign Het
Xpo1 A G 11: 23,281,399 T328A probably benign Het
Xrcc5 C T 1: 72,319,096 L197F possibly damaging Het
Zfhx2 G C 14: 55,073,944 S431C possibly damaging Het
Zfp410 C T 12: 84,325,720 P54S probably benign Het
Zfp560 C A 9: 20,347,986 G527* probably null Het
Zfp775 A G 6: 48,619,455 T88A possibly damaging Het
Zfp780b T A 7: 27,964,383 H249L possibly damaging Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1895:Col4a3 UTSW 1 82679108 missense unknown
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 splice site probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 splice site probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
R7994:Col4a3 UTSW 1 82662906 missense unknown
R8127:Col4a3 UTSW 1 82649760 missense unknown
R8702:Col4a3 UTSW 1 82710979 missense unknown
R8865:Col4a3 UTSW 1 82669762 critical splice donor site probably null
R8973:Col4a3 UTSW 1 82715331 missense probably benign 0.11
R9611:Col4a3 UTSW 1 82700297 missense unknown
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acaagcaaacaaacaagcaaac -3'
Posted On 2014-05-14