Incidental Mutation 'R1694:Myh7b'
ID 191989
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
MMRRC Submission 039727-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1694 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 155453132-155476227 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155455113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 46 (E46V)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
AlphaFold A2AQP0
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: E46V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: E46V

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T C 10: 120,614,533 (GRCm39) probably benign Het
4930447C04Rik C T 12: 72,931,992 (GRCm39) probably null Het
Abca16 A G 7: 120,119,307 (GRCm39) H1017R probably damaging Het
Actl11 A G 9: 107,807,207 (GRCm39) Y510C probably damaging Het
Agbl2 A G 2: 90,631,664 (GRCm39) T341A probably damaging Het
Agbl5 A G 5: 31,050,726 (GRCm39) Y458C probably damaging Het
Akap5 C T 12: 76,376,698 (GRCm39) S710L probably damaging Het
Akr1c21 A G 13: 4,625,177 (GRCm39) E36G probably damaging Het
Arhgap44 A G 11: 64,944,023 (GRCm39) S163P probably damaging Het
Armc1 A G 3: 19,189,050 (GRCm39) V205A possibly damaging Het
Asph A G 4: 9,610,869 (GRCm39) L102P probably damaging Het
Brca1 T C 11: 101,422,925 (GRCm39) E74G probably damaging Het
Brms1l A G 12: 55,888,385 (GRCm39) R58G probably damaging Het
C1qbp G T 11: 70,869,073 (GRCm39) probably null Het
Calcrl A T 2: 84,169,631 (GRCm39) L350H probably damaging Het
Casr A T 16: 36,315,953 (GRCm39) F706I probably damaging Het
Ceacam10 T A 7: 24,480,491 (GRCm39) N87K probably benign Het
Cfap206 G T 4: 34,719,058 (GRCm39) T316K probably damaging Het
Col4a3 A T 1: 82,668,384 (GRCm39) probably null Het
Comtd1 A G 14: 21,897,398 (GRCm39) V183A probably damaging Het
Crygs A T 16: 22,625,425 (GRCm39) probably null Het
Dact1 C A 12: 71,359,551 (GRCm39) T139K probably damaging Het
Dlx6 T C 6: 6,867,173 (GRCm39) W259R probably damaging Het
Dnah9 G T 11: 65,845,650 (GRCm39) S627* probably null Het
Dnajc11 T A 4: 152,063,730 (GRCm39) V442D probably damaging Het
Dnajc21 A T 15: 10,451,649 (GRCm39) S393T probably benign Het
Dpysl3 C A 18: 43,461,439 (GRCm39) C584F possibly damaging Het
Efcab14 A G 4: 115,603,736 (GRCm39) K138R possibly damaging Het
Ephb3 A G 16: 21,040,495 (GRCm39) E577G probably damaging Het
Exoc3 C T 13: 74,338,184 (GRCm39) probably null Het
Fam171a1 A G 2: 3,226,660 (GRCm39) S473G probably benign Het
Fbxl2 A T 9: 113,832,239 (GRCm39) F58L probably damaging Het
Fmo6 T C 1: 162,750,241 (GRCm39) M272V probably benign Het
Gm10000 T C 12: 104,442,859 (GRCm39) probably benign Het
Grik1 T A 16: 87,746,956 (GRCm39) D442V probably damaging Het
Hectd1 A G 12: 51,791,375 (GRCm39) Y2588H probably damaging Het
Insrr A C 3: 87,711,369 (GRCm39) T430P probably benign Het
Lats1 T C 10: 7,577,709 (GRCm39) S278P probably benign Het
Lrch4 A G 5: 137,636,723 (GRCm39) T463A probably benign Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Lyst T G 13: 13,835,746 (GRCm39) F1809L probably damaging Het
Mad2l1bp A G 17: 46,463,770 (GRCm39) Y85H possibly damaging Het
Magoh G T 4: 107,740,362 (GRCm39) R82L probably benign Het
Mdfic2 A C 6: 98,215,100 (GRCm39) S174R probably damaging Het
Mlh1 A G 9: 111,057,543 (GRCm39) V756A probably damaging Het
Mlh3 T C 12: 85,313,915 (GRCm39) E757G probably damaging Het
Mycbp2 T C 14: 103,464,947 (GRCm39) T1339A probably damaging Het
Naalad2 T A 9: 18,238,683 (GRCm39) R677S probably damaging Het
Nadsyn1 G A 7: 143,361,749 (GRCm39) T324I probably benign Het
Neo1 A T 9: 58,787,886 (GRCm39) L1389Q probably damaging Het
Nlrp1b A G 11: 71,107,681 (GRCm39) probably null Het
Nup210 A C 6: 91,039,785 (GRCm39) I690S probably benign Het
Or55b3 A T 7: 102,126,547 (GRCm39) S177T probably benign Het
Or5an11 T A 19: 12,246,281 (GRCm39) I229N probably damaging Het
Or9r7 T A 10: 129,962,123 (GRCm39) I268F possibly damaging Het
Otud7a C A 7: 63,383,458 (GRCm39) H316N probably damaging Het
Pcdh15 T C 10: 74,429,995 (GRCm39) S1241P probably damaging Het
Pclo A G 5: 14,570,977 (GRCm39) K121E probably damaging Het
Pcmtd1 A T 1: 7,217,872 (GRCm39) I107L probably benign Het
Pde6c A G 19: 38,168,673 (GRCm39) I755V probably damaging Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,927,719 (GRCm39) probably benign Het
Pi4ka A T 16: 17,113,240 (GRCm39) I1532N probably damaging Het
Pla2r1 A G 2: 60,271,428 (GRCm39) probably null Het
Plb1 A G 5: 32,474,621 (GRCm39) N661S probably null Het
Plekhd1 A G 12: 80,769,095 (GRCm39) K452E possibly damaging Het
Prr12 C A 7: 44,678,003 (GRCm39) V2003F unknown Het
Ptger1 G A 8: 84,395,107 (GRCm39) G195R probably benign Het
Ptpn4 T C 1: 119,711,240 (GRCm39) Q67R probably damaging Het
Rgsl1 C T 1: 153,680,422 (GRCm39) R760H probably damaging Het
Rock1 A G 18: 10,136,094 (GRCm39) probably null Het
Rtn1 T C 12: 72,270,298 (GRCm39) Y71C probably damaging Het
Rtp4 T C 16: 23,431,870 (GRCm39) *62Q probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,026,745 (GRCm39) probably benign Het
Scimp G T 11: 70,684,618 (GRCm39) P78H probably damaging Het
Scn8a C A 15: 100,853,409 (GRCm39) S132* probably null Het
Set A G 2: 29,959,436 (GRCm39) I124M probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Sgce A G 6: 4,689,709 (GRCm39) S375P probably damaging Het
Slc4a1ap G C 5: 31,701,098 (GRCm39) E600Q probably damaging Het
Slit1 A G 19: 41,626,031 (GRCm39) V577A possibly damaging Het
Sqstm1 A G 11: 50,098,307 (GRCm39) V153A probably benign Het
Src A G 2: 157,311,675 (GRCm39) M468V possibly damaging Het
Srrm3 A G 5: 135,902,079 (GRCm39) probably benign Het
Stk11ip C T 1: 75,504,030 (GRCm39) R257W probably damaging Het
Tfrc T A 16: 32,433,443 (GRCm39) D32E probably damaging Het
Tor1aip2 A T 1: 155,941,031 (GRCm39) I446L probably benign Het
Trmt11 T C 10: 30,411,221 (GRCm39) H424R probably benign Het
Urb1 A G 16: 90,563,928 (GRCm39) Y1612H probably benign Het
Vcan A T 13: 89,836,602 (GRCm39) S2981T probably damaging Het
Vdac1 G C 11: 52,265,190 (GRCm39) G21A probably damaging Het
Vmn2r76 A G 7: 85,879,356 (GRCm39) S315P probably benign Het
Xpo1 A G 11: 23,231,399 (GRCm39) T328A probably benign Het
Xrcc5 C T 1: 72,358,255 (GRCm39) L197F possibly damaging Het
Zfhx2 G C 14: 55,311,401 (GRCm39) S431C possibly damaging Het
Zfp410 C T 12: 84,372,494 (GRCm39) P54S probably benign Het
Zfp560 C A 9: 20,259,282 (GRCm39) G527* probably null Het
Zfp775 A G 6: 48,596,389 (GRCm39) T88A possibly damaging Het
Zfp780b T A 7: 27,663,808 (GRCm39) H249L possibly damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155,472,212 (GRCm39) missense probably damaging 0.99
IGL01604:Myh7b APN 2 155,474,327 (GRCm39) missense probably damaging 0.96
IGL02179:Myh7b APN 2 155,456,411 (GRCm39) missense probably benign 0.02
IGL02729:Myh7b APN 2 155,467,609 (GRCm39) missense probably damaging 1.00
IGL02804:Myh7b APN 2 155,467,643 (GRCm39) missense probably damaging 1.00
IGL02851:Myh7b APN 2 155,470,747 (GRCm39) missense probably damaging 1.00
IGL02956:Myh7b APN 2 155,467,874 (GRCm39) missense possibly damaging 0.95
IGL02956:Myh7b APN 2 155,474,823 (GRCm39) missense probably damaging 1.00
IGL02992:Myh7b APN 2 155,463,330 (GRCm39) missense probably damaging 0.99
IGL03060:Myh7b APN 2 155,474,671 (GRCm39) missense probably damaging 1.00
IGL03061:Myh7b APN 2 155,462,031 (GRCm39) missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155,462,403 (GRCm39) nonsense probably null
IGL03246:Myh7b APN 2 155,459,792 (GRCm39) missense probably damaging 1.00
IGL03382:Myh7b APN 2 155,465,399 (GRCm39) missense probably damaging 1.00
euclidian UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
imaginary UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
Irrational UTSW 2 155,472,592 (GRCm39) unclassified probably benign
Muscoli UTSW 2 155,462,038 (GRCm39) nonsense probably null
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0109:Myh7b UTSW 2 155,453,594 (GRCm39) missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155,472,592 (GRCm39) unclassified probably benign
R0567:Myh7b UTSW 2 155,468,318 (GRCm39) missense probably damaging 1.00
R0619:Myh7b UTSW 2 155,453,642 (GRCm39) missense probably benign 0.00
R0927:Myh7b UTSW 2 155,462,040 (GRCm39) missense probably damaging 1.00
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0974:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R1137:Myh7b UTSW 2 155,464,634 (GRCm39) missense probably damaging 1.00
R1261:Myh7b UTSW 2 155,463,003 (GRCm39) missense probably benign 0.00
R1268:Myh7b UTSW 2 155,455,966 (GRCm39) nonsense probably null
R1537:Myh7b UTSW 2 155,473,707 (GRCm39) missense probably damaging 0.96
R1632:Myh7b UTSW 2 155,462,445 (GRCm39) missense probably benign 0.04
R1697:Myh7b UTSW 2 155,462,054 (GRCm39) missense probably damaging 1.00
R1730:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155,472,778 (GRCm39) missense probably damaging 0.96
R1783:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155,471,377 (GRCm39) missense probably benign 0.00
R2140:Myh7b UTSW 2 155,462,043 (GRCm39) missense probably damaging 1.00
R2971:Myh7b UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
R3838:Myh7b UTSW 2 155,474,909 (GRCm39) missense probably damaging 1.00
R4074:Myh7b UTSW 2 155,460,678 (GRCm39) missense probably damaging 0.96
R4191:Myh7b UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
R4689:Myh7b UTSW 2 155,472,434 (GRCm39) missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155,456,097 (GRCm39) missense probably damaging 1.00
R4697:Myh7b UTSW 2 155,471,242 (GRCm39) missense probably damaging 1.00
R4771:Myh7b UTSW 2 155,468,314 (GRCm39) nonsense probably null
R4794:Myh7b UTSW 2 155,465,186 (GRCm39) missense probably benign 0.00
R4842:Myh7b UTSW 2 155,475,909 (GRCm39) missense probably benign 0.45
R4871:Myh7b UTSW 2 155,455,420 (GRCm39) missense probably benign 0.18
R5022:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155,473,670 (GRCm39) missense probably benign 0.00
R5055:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155,474,234 (GRCm39) missense probably benign
R5422:Myh7b UTSW 2 155,472,954 (GRCm39) missense probably damaging 0.99
R5505:Myh7b UTSW 2 155,474,592 (GRCm39) missense probably benign 0.01
R5946:Myh7b UTSW 2 155,463,315 (GRCm39) missense probably damaging 1.00
R6089:Myh7b UTSW 2 155,464,409 (GRCm39) missense probably damaging 1.00
R6103:Myh7b UTSW 2 155,460,663 (GRCm39) missense probably damaging 1.00
R6233:Myh7b UTSW 2 155,473,719 (GRCm39) missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155,474,316 (GRCm39) missense probably damaging 1.00
R6350:Myh7b UTSW 2 155,470,680 (GRCm39) missense probably benign 0.00
R6484:Myh7b UTSW 2 155,470,563 (GRCm39) missense probably benign 0.05
R6760:Myh7b UTSW 2 155,462,038 (GRCm39) nonsense probably null
R6896:Myh7b UTSW 2 155,464,488 (GRCm39) critical splice donor site probably null
R6945:Myh7b UTSW 2 155,464,152 (GRCm39) missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155,473,671 (GRCm39) missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155,456,053 (GRCm39) missense probably damaging 1.00
R7102:Myh7b UTSW 2 155,464,119 (GRCm39) missense probably damaging 1.00
R7248:Myh7b UTSW 2 155,464,106 (GRCm39) missense probably damaging 1.00
R7303:Myh7b UTSW 2 155,460,660 (GRCm39) missense probably damaging 1.00
R7360:Myh7b UTSW 2 155,474,460 (GRCm39) missense probably benign 0.38
R7652:Myh7b UTSW 2 155,474,156 (GRCm39) missense probably damaging 0.99
R7678:Myh7b UTSW 2 155,459,698 (GRCm39) splice site probably null
R7703:Myh7b UTSW 2 155,462,356 (GRCm39) missense probably null 1.00
R7711:Myh7b UTSW 2 155,462,323 (GRCm39) missense probably damaging 1.00
R7923:Myh7b UTSW 2 155,467,886 (GRCm39) missense probably benign
R7967:Myh7b UTSW 2 155,456,119 (GRCm39) splice site probably null
R8045:Myh7b UTSW 2 155,455,101 (GRCm39) missense probably benign 0.00
R8176:Myh7b UTSW 2 155,467,886 (GRCm39) missense probably benign 0.06
R8272:Myh7b UTSW 2 155,474,824 (GRCm39) missense probably damaging 1.00
R8560:Myh7b UTSW 2 155,465,124 (GRCm39) missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155,453,669 (GRCm39) critical splice donor site probably null
R8824:Myh7b UTSW 2 155,472,301 (GRCm39) missense probably benign 0.02
R8832:Myh7b UTSW 2 155,475,182 (GRCm39) missense probably benign 0.00
R9079:Myh7b UTSW 2 155,465,174 (GRCm39) missense probably damaging 0.97
R9151:Myh7b UTSW 2 155,474,439 (GRCm39) missense probably damaging 1.00
R9311:Myh7b UTSW 2 155,463,253 (GRCm39) missense probably damaging 1.00
R9332:Myh7b UTSW 2 155,470,722 (GRCm39) missense probably damaging 1.00
R9357:Myh7b UTSW 2 155,463,268 (GRCm39) missense probably damaging 1.00
R9388:Myh7b UTSW 2 155,472,983 (GRCm39) missense probably benign 0.28
R9583:Myh7b UTSW 2 155,459,641 (GRCm39) missense probably damaging 1.00
R9657:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
R9738:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
X0013:Myh7b UTSW 2 155,473,089 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGAGAGTCTGCACTGGAATGTC -3'
(R):5'- CACGTAGATCATCCAGCGAGCATAG -3'

Sequencing Primer
(F):5'- GCACTGGAATGTCTATAAACTGGC -3'
(R):5'- TGTCCTCCAGTAAGTCGAAACG -3'
Posted On 2014-05-14