Mutagenetix > Incidental Mutations

Incidental Mutation 'R1694:Insrr'

191992

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

039727-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.355) question?

Stock #

R1694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 87804062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 430 (T430P)

Ref Sequence

ENSEMBL: ENSMUSP00000103208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

AlphaFold

Q9WTL4

Predicted Effect

probably benign
Transcript: ENSMUST00000029711
AA Change: T430P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: T430P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107582
AA Change: T430P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: T430P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166771

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166866

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513I03Rik	T	C	10: 120,778,628		probably benign	Het
4930447C04Rik	C	T	12: 72,885,218		probably null	Het
Abca16	A	G	7: 120,520,084	H1017R	probably damaging	Het
Actl11	A	G	9: 107,930,008	Y510C	probably damaging	Het
Agbl2	A	G	2: 90,801,320	T341A	probably damaging	Het
Agbl5	A	G	5: 30,893,382	Y458C	probably damaging	Het
Akap5	C	T	12: 76,329,924	S710L	probably damaging	Het
Akr1c21	A	G	13: 4,575,178	E36G	probably damaging	Het
Arhgap44	A	G	11: 65,053,197	S163P	probably damaging	Het
Armc1	A	G	3: 19,134,886	V205A	possibly damaging	Het
Asph	A	G	4: 9,610,869	L102P	probably damaging	Het
Brca1	T	C	11: 101,532,099	E74G	probably damaging	Het
Brms1l	A	G	12: 55,841,600	R58G	probably damaging	Het
C1qbp	G	T	11: 70,978,247		probably null	Het
Calcrl	A	T	2: 84,339,287	L350H	probably damaging	Het
Casr	A	T	16: 36,495,591	F706I	probably damaging	Het
Ceacam10	T	A	7: 24,781,066	N87K	probably benign	Het
Cfap206	G	T	4: 34,719,058	T316K	probably damaging	Het
Col4a3	A	T	1: 82,690,663		probably null	Het
Comtd1	A	G	14: 21,847,330	V183A	probably damaging	Het
Crygs	A	T	16: 22,806,675		probably null	Het
Dact1	C	A	12: 71,312,777	T139K	probably damaging	Het
Dlx6	T	C	6: 6,867,173	W259R	probably damaging	Het
Dnah9	G	T	11: 65,954,824	S627*	probably null	Het
Dnajc11	T	A	4: 151,979,273	V442D	probably damaging	Het
Dnajc21	A	T	15: 10,451,563	S393T	probably benign	Het
Dpysl3	C	A	18: 43,328,374	C584F	possibly damaging	Het
Efcab14	A	G	4: 115,746,539	K138R	possibly damaging	Het
Ephb3	A	G	16: 21,221,745	E577G	probably damaging	Het
Exoc3	C	T	13: 74,190,065		probably null	Het
Fam171a1	A	G	2: 3,225,623	S473G	probably benign	Het
Fbxl2	A	T	9: 114,003,171	F58L	probably damaging	Het
Fmo6	T	C	1: 162,922,672	M272V	probably benign	Het
Gm1000	T	C	12: 104,476,600		probably benign	Het
Gm765	A	C	6: 98,238,139	S174R	probably damaging	Het
Grik1	T	A	16: 87,950,068	D442V	probably damaging	Het
Hectd1	A	G	12: 51,744,592	Y2588H	probably damaging	Het
Lats1	T	C	10: 7,701,945	S278P	probably benign	Het
Lrch4	A	G	5: 137,638,461	T463A	probably benign	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Lyst	T	G	13: 13,661,161	F1809L	probably damaging	Het
Mad2l1bp	A	G	17: 46,152,844	Y85H	possibly damaging	Het
Magoh	G	T	4: 107,883,165	R82L	probably benign	Het
Mlh1	A	G	9: 111,228,475	V756A	probably damaging	Het
Mlh3	T	C	12: 85,267,141	E757G	probably damaging	Het
Mycbp2	T	C	14: 103,227,511	T1339A	probably damaging	Het
Myh7b	A	T	2: 155,613,193	E46V	probably damaging	Het
Naalad2	T	A	9: 18,327,387	R677S	probably damaging	Het
Nadsyn1	G	A	7: 143,808,012	T324I	probably benign	Het
Neo1	A	T	9: 58,880,603	L1389Q	probably damaging	Het
Nlrp1b	A	G	11: 71,216,855		probably null	Het
Nup210	A	C	6: 91,062,803	I690S	probably benign	Het
Olfr235	T	A	19: 12,268,917	I229N	probably damaging	Het
Olfr543	A	T	7: 102,477,340	S177T	probably benign	Het
Olfr824	T	A	10: 130,126,254	I268F	possibly damaging	Het
Otud7a	C	A	7: 63,733,710	H316N	probably damaging	Het
Pcdh15	T	C	10: 74,594,163	S1241P	probably damaging	Het
Pclo	A	G	5: 14,520,963	K121E	probably damaging	Het
Pcmtd1	A	T	1: 7,147,648	I107L	probably benign	Het
Pde6c	A	G	19: 38,180,225	I755V	probably damaging	Het
Pes1	CGGAGGAGGAGGAGGAGGAGGAGG	CGGAGGAGGAGGAGGAGGAGG	11: 3,977,719		probably benign	Het
Pi4ka	A	T	16: 17,295,376	I1532N	probably damaging	Het
Pla2r1	A	G	2: 60,441,084		probably null	Het
Plb1	A	G	5: 32,317,277	N661S	probably null	Het
Plekhd1	A	G	12: 80,722,321	K452E	possibly damaging	Het
Prr12	C	A	7: 45,028,579	V2003F	unknown	Het
Ptger1	G	A	8: 83,668,478	G195R	probably benign	Het
Ptpn4	T	C	1: 119,783,510	Q67R	probably damaging	Het
Rgsl1	C	T	1: 153,804,676	R760H	probably damaging	Het
Rock1	A	G	18: 10,136,094		probably null	Het
Rtn1	T	C	12: 72,223,524	Y71C	probably damaging	Het
Rtp4	T	C	16: 23,613,120	*62Q	probably null	Het
Scaf4	GGCTGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTGCTG	16: 90,229,857		probably benign	Het
Scimp	G	T	11: 70,793,792	P78H	probably damaging	Het
Scn8a	C	A	15: 100,955,528	S132*	probably null	Het
Set	A	G	2: 30,069,424	I124M	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sgce	A	G	6: 4,689,709	S375P	probably damaging	Het
Slc4a1ap	G	C	5: 31,543,754	E600Q	probably damaging	Het
Slit1	A	G	19: 41,637,592	V577A	possibly damaging	Het
Sqstm1	A	G	11: 50,207,480	V153A	probably benign	Het
Src	A	G	2: 157,469,755	M468V	possibly damaging	Het
Srrm3	A	G	5: 135,873,225		probably benign	Het
Stk11ip	C	T	1: 75,527,386	R257W	probably damaging	Het
Tfrc	T	A	16: 32,614,625	D32E	probably damaging	Het
Tor1aip2	A	T	1: 156,065,285	I446L	probably benign	Het
Trmt11	T	C	10: 30,535,225	H424R	probably benign	Het
Urb1	A	G	16: 90,767,040	Y1612H	probably benign	Het
Vcan	A	T	13: 89,688,483	S2981T	probably damaging	Het
Vdac1	G	C	11: 52,374,363	G21A	probably damaging	Het
Vmn2r76	A	G	7: 86,230,148	S315P	probably benign	Het
Xpo1	A	G	11: 23,281,399	T328A	probably benign	Het
Xrcc5	C	T	1: 72,319,096	L197F	possibly damaging	Het
Zfhx2	G	C	14: 55,073,944	S431C	possibly damaging	Het
Zfp410	C	T	12: 84,325,720	P54S	probably benign	Het
Zfp560	C	A	9: 20,347,986	G527*	probably null	Het
Zfp775	A	G	6: 48,619,455	T88A	possibly damaging	Het
Zfp780b	T	A	7: 27,964,383	H249L	possibly damaging	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	splice site	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87808646	splice site	probably null
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87800490	missense	probably damaging	1.00
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2220:Insrr	UTSW	3	87809418	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87810700	splice site	probably null
R5685:Insrr	UTSW	3	87800496	splice site	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87815244	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87808594	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87803133	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87814316	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87808732	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87804531	splice site	probably null
R7815:Insrr	UTSW	3	87808695	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87800428	missense	probably damaging	1.00
R8289:Insrr	UTSW	3	87814194	missense	probably damaging	1.00
R8309:Insrr	UTSW	3	87810442	missense	probably benign	0.00
R8312:Insrr	UTSW	3	87800484	missense	possibly damaging	0.93
R8445:Insrr	UTSW	3	87813584	missense	probably damaging	1.00
R8917:Insrr	UTSW	3	87810969	missense	probably benign	0.00
R8960:Insrr	UTSW	3	87813079	missense	probably damaging	1.00
R8989:Insrr	UTSW	3	87815357	missense	probably damaging	0.96
R9015:Insrr	UTSW	3	87813603	missense	probably damaging	1.00
R9202:Insrr	UTSW	3	87813120	missense	probably damaging	1.00
R9251:Insrr	UTSW	3	87810084	missense	probably benign	0.08
R9327:Insrr	UTSW	3	87814297	missense	probably damaging	1.00
RF022:Insrr	UTSW	3	87804485	missense	possibly damaging	0.51
Z1177:Insrr	UTSW	3	87800827	missense	possibly damaging	0.91
Z1192:Insrr	UTSW	3	87802579	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGCCCCTCATGAATGTGAGTG -3'
(R):5'- CAAAACGTAGAGTGCGAGTCTGACC -3'

Sequencing Primer
(F):5'- ATGTGAGTGGCTGGCAGAC -3'
(R):5'- AAAGCACCTGCTTCAGGGTC -3'

Posted On

2014-05-14