Incidental Mutation 'R1694:Nadsyn1'
ID192020
Institutional Source Beutler Lab
Gene Symbol Nadsyn1
Ensembl Gene ENSMUSG00000031090
Gene NameNAD synthetase 1
Synonyms9130012B15Rik
MMRRC Submission 039727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1694 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location143795584-143822849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143808012 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 324 (T324I)
Ref Sequence ENSEMBL: ENSMUSP00000033415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033415] [ENSMUST00000132520] [ENSMUST00000143366] [ENSMUST00000156638]
Predicted Effect probably benign
Transcript: ENSMUST00000033415
AA Change: T324I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033415
Gene: ENSMUSG00000031090
AA Change: T324I

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 283 3.2e-52 PFAM
Pfam:NAD_synthase 337 649 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132520
AA Change: T324I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114380
Gene: ENSMUSG00000031090
AA Change: T324I

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 201 6.3e-39 PFAM
Pfam:NAD_synthase 336 561 8.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143366
SMART Domains Protein: ENSMUSP00000115857
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156638
SMART Domains Protein: ENSMUSP00000114889
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T C 10: 120,778,628 probably benign Het
4930447C04Rik C T 12: 72,885,218 probably null Het
Abca16 A G 7: 120,520,084 H1017R probably damaging Het
Actl11 A G 9: 107,930,008 Y510C probably damaging Het
Agbl2 A G 2: 90,801,320 T341A probably damaging Het
Agbl5 A G 5: 30,893,382 Y458C probably damaging Het
Akap5 C T 12: 76,329,924 S710L probably damaging Het
Akr1c21 A G 13: 4,575,178 E36G probably damaging Het
Arhgap44 A G 11: 65,053,197 S163P probably damaging Het
Armc1 A G 3: 19,134,886 V205A possibly damaging Het
Asph A G 4: 9,610,869 L102P probably damaging Het
Brca1 T C 11: 101,532,099 E74G probably damaging Het
Brms1l A G 12: 55,841,600 R58G probably damaging Het
C1qbp G T 11: 70,978,247 probably null Het
Calcrl A T 2: 84,339,287 L350H probably damaging Het
Casr A T 16: 36,495,591 F706I probably damaging Het
Ceacam10 T A 7: 24,781,066 N87K probably benign Het
Cfap206 G T 4: 34,719,058 T316K probably damaging Het
Col4a3 A T 1: 82,690,663 probably null Het
Comtd1 A G 14: 21,847,330 V183A probably damaging Het
Crygs A T 16: 22,806,675 probably null Het
Dact1 C A 12: 71,312,777 T139K probably damaging Het
Dlx6 T C 6: 6,867,173 W259R probably damaging Het
Dnah9 G T 11: 65,954,824 S627* probably null Het
Dnajc11 T A 4: 151,979,273 V442D probably damaging Het
Dnajc21 A T 15: 10,451,563 S393T probably benign Het
Dpysl3 C A 18: 43,328,374 C584F possibly damaging Het
Efcab14 A G 4: 115,746,539 K138R possibly damaging Het
Ephb3 A G 16: 21,221,745 E577G probably damaging Het
Exoc3 C T 13: 74,190,065 probably null Het
Fam171a1 A G 2: 3,225,623 S473G probably benign Het
Fbxl2 A T 9: 114,003,171 F58L probably damaging Het
Fmo6 T C 1: 162,922,672 M272V probably benign Het
Gm1000 T C 12: 104,476,600 probably benign Het
Gm765 A C 6: 98,238,139 S174R probably damaging Het
Grik1 T A 16: 87,950,068 D442V probably damaging Het
Hectd1 A G 12: 51,744,592 Y2588H probably damaging Het
Insrr A C 3: 87,804,062 T430P probably benign Het
Lats1 T C 10: 7,701,945 S278P probably benign Het
Lrch4 A G 5: 137,638,461 T463A probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Lyst T G 13: 13,661,161 F1809L probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Magoh G T 4: 107,883,165 R82L probably benign Het
Mlh1 A G 9: 111,228,475 V756A probably damaging Het
Mlh3 T C 12: 85,267,141 E757G probably damaging Het
Mycbp2 T C 14: 103,227,511 T1339A probably damaging Het
Myh7b A T 2: 155,613,193 E46V probably damaging Het
Naalad2 T A 9: 18,327,387 R677S probably damaging Het
Neo1 A T 9: 58,880,603 L1389Q probably damaging Het
Nlrp1b A G 11: 71,216,855 probably null Het
Nup210 A C 6: 91,062,803 I690S probably benign Het
Olfr235 T A 19: 12,268,917 I229N probably damaging Het
Olfr543 A T 7: 102,477,340 S177T probably benign Het
Olfr824 T A 10: 130,126,254 I268F possibly damaging Het
Otud7a C A 7: 63,733,710 H316N probably damaging Het
Pcdh15 T C 10: 74,594,163 S1241P probably damaging Het
Pclo A G 5: 14,520,963 K121E probably damaging Het
Pcmtd1 A T 1: 7,147,648 I107L probably benign Het
Pde6c A G 19: 38,180,225 I755V probably damaging Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Pi4ka A T 16: 17,295,376 I1532N probably damaging Het
Pla2r1 A G 2: 60,441,084 probably null Het
Plb1 A G 5: 32,317,277 N661S probably null Het
Plekhd1 A G 12: 80,722,321 K452E possibly damaging Het
Prr12 C A 7: 45,028,579 V2003F unknown Het
Ptger1 G A 8: 83,668,478 G195R probably benign Het
Ptpn4 T C 1: 119,783,510 Q67R probably damaging Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rock1 A G 18: 10,136,094 probably null Het
Rtn1 T C 12: 72,223,524 Y71C probably damaging Het
Rtp4 T C 16: 23,613,120 *62Q probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scimp G T 11: 70,793,792 P78H probably damaging Het
Scn8a C A 15: 100,955,528 S132* probably null Het
Set A G 2: 30,069,424 I124M probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sgce A G 6: 4,689,709 S375P probably damaging Het
Slc4a1ap G C 5: 31,543,754 E600Q probably damaging Het
Slit1 A G 19: 41,637,592 V577A possibly damaging Het
Sqstm1 A G 11: 50,207,480 V153A probably benign Het
Src A G 2: 157,469,755 M468V possibly damaging Het
Srrm3 A G 5: 135,873,225 probably benign Het
Stk11ip C T 1: 75,527,386 R257W probably damaging Het
Tfrc T A 16: 32,614,625 D32E probably damaging Het
Tor1aip2 A T 1: 156,065,285 I446L probably benign Het
Trmt11 T C 10: 30,535,225 H424R probably benign Het
Urb1 A G 16: 90,767,040 Y1612H probably benign Het
Vcan A T 13: 89,688,483 S2981T probably damaging Het
Vdac1 G C 11: 52,374,363 G21A probably damaging Het
Vmn2r76 A G 7: 86,230,148 S315P probably benign Het
Xpo1 A G 11: 23,281,399 T328A probably benign Het
Xrcc5 C T 1: 72,319,096 L197F possibly damaging Het
Zfhx2 G C 14: 55,073,944 S431C possibly damaging Het
Zfp410 C T 12: 84,325,720 P54S probably benign Het
Zfp560 C A 9: 20,347,986 G527* probably null Het
Zfp775 A G 6: 48,619,455 T88A possibly damaging Het
Zfp780b T A 7: 27,964,383 H249L possibly damaging Het
Other mutations in Nadsyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Nadsyn1 APN 7 143812793 missense probably damaging 1.00
IGL01359:Nadsyn1 APN 7 143821230 missense possibly damaging 0.74
IGL01412:Nadsyn1 APN 7 143808790 critical splice donor site probably null
IGL01481:Nadsyn1 APN 7 143812584 missense probably damaging 1.00
IGL01642:Nadsyn1 APN 7 143797878 missense probably damaging 1.00
IGL02110:Nadsyn1 APN 7 143813427 missense probably damaging 1.00
IGL02126:Nadsyn1 APN 7 143804016 nonsense probably null
IGL02173:Nadsyn1 APN 7 143804006 splice site probably benign
IGL02351:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL02358:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL03216:Nadsyn1 APN 7 143797845 missense probably damaging 1.00
R0029:Nadsyn1 UTSW 7 143806078 missense probably benign 0.01
R0036:Nadsyn1 UTSW 7 143811291 missense probably benign 0.23
R0968:Nadsyn1 UTSW 7 143806033 missense probably benign 0.30
R1487:Nadsyn1 UTSW 7 143806925 missense probably benign 0.31
R1874:Nadsyn1 UTSW 7 143797844 missense probably damaging 1.00
R4540:Nadsyn1 UTSW 7 143803223 missense probably damaging 1.00
R4742:Nadsyn1 UTSW 7 143798630 intron probably benign
R4755:Nadsyn1 UTSW 7 143806913 missense probably damaging 1.00
R5045:Nadsyn1 UTSW 7 143806969 missense probably damaging 1.00
R5288:Nadsyn1 UTSW 7 143803286 missense possibly damaging 0.95
R5326:Nadsyn1 UTSW 7 143808830 missense probably benign 0.42
R5666:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5669:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5691:Nadsyn1 UTSW 7 143812579 unclassified probably null
R5861:Nadsyn1 UTSW 7 143811227 missense possibly damaging 0.80
R6213:Nadsyn1 UTSW 7 143799812 missense probably benign 0.05
R6624:Nadsyn1 UTSW 7 143805973 missense probably benign 0.02
R6652:Nadsyn1 UTSW 7 143811218 missense probably benign 0.03
R6791:Nadsyn1 UTSW 7 143819108 missense probably damaging 1.00
R7144:Nadsyn1 UTSW 7 143811215 missense probably damaging 0.99
R7559:Nadsyn1 UTSW 7 143808067 missense probably benign 0.00
R7770:Nadsyn1 UTSW 7 143806003 missense probably damaging 1.00
R7802:Nadsyn1 UTSW 7 143806026 missense probably benign
R7871:Nadsyn1 UTSW 7 143798496 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGGCCTGTTCAGTCATAGCATC -3'
(R):5'- CCTTCCCACAGTTCAAGGAAAGCTC -3'

Sequencing Primer
(F):5'- gcggccactggatctttaac -3'
(R):5'- GGTCAGCACATGTCAACTTTG -3'
Posted On2014-05-14