Incidental Mutation 'R1694:Lats1'
ID 192029
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Name large tumor suppressor
Synonyms
MMRRC Submission 039727-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.847) question?
Stock # R1694 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 7556978-7592224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7577709 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 278 (S278P)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
AlphaFold Q8BYR2
Predicted Effect probably benign
Transcript: ENSMUST00000040043
AA Change: S278P

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: S278P

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165952
AA Change: S278P

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: S278P

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217931
AA Change: S278P

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T C 10: 120,614,533 (GRCm39) probably benign Het
4930447C04Rik C T 12: 72,931,992 (GRCm39) probably null Het
Abca16 A G 7: 120,119,307 (GRCm39) H1017R probably damaging Het
Actl11 A G 9: 107,807,207 (GRCm39) Y510C probably damaging Het
Agbl2 A G 2: 90,631,664 (GRCm39) T341A probably damaging Het
Agbl5 A G 5: 31,050,726 (GRCm39) Y458C probably damaging Het
Akap5 C T 12: 76,376,698 (GRCm39) S710L probably damaging Het
Akr1c21 A G 13: 4,625,177 (GRCm39) E36G probably damaging Het
Arhgap44 A G 11: 64,944,023 (GRCm39) S163P probably damaging Het
Armc1 A G 3: 19,189,050 (GRCm39) V205A possibly damaging Het
Asph A G 4: 9,610,869 (GRCm39) L102P probably damaging Het
Brca1 T C 11: 101,422,925 (GRCm39) E74G probably damaging Het
Brms1l A G 12: 55,888,385 (GRCm39) R58G probably damaging Het
C1qbp G T 11: 70,869,073 (GRCm39) probably null Het
Calcrl A T 2: 84,169,631 (GRCm39) L350H probably damaging Het
Casr A T 16: 36,315,953 (GRCm39) F706I probably damaging Het
Ceacam10 T A 7: 24,480,491 (GRCm39) N87K probably benign Het
Cfap206 G T 4: 34,719,058 (GRCm39) T316K probably damaging Het
Col4a3 A T 1: 82,668,384 (GRCm39) probably null Het
Comtd1 A G 14: 21,897,398 (GRCm39) V183A probably damaging Het
Crygs A T 16: 22,625,425 (GRCm39) probably null Het
Dact1 C A 12: 71,359,551 (GRCm39) T139K probably damaging Het
Dlx6 T C 6: 6,867,173 (GRCm39) W259R probably damaging Het
Dnah9 G T 11: 65,845,650 (GRCm39) S627* probably null Het
Dnajc11 T A 4: 152,063,730 (GRCm39) V442D probably damaging Het
Dnajc21 A T 15: 10,451,649 (GRCm39) S393T probably benign Het
Dpysl3 C A 18: 43,461,439 (GRCm39) C584F possibly damaging Het
Efcab14 A G 4: 115,603,736 (GRCm39) K138R possibly damaging Het
Ephb3 A G 16: 21,040,495 (GRCm39) E577G probably damaging Het
Exoc3 C T 13: 74,338,184 (GRCm39) probably null Het
Fam171a1 A G 2: 3,226,660 (GRCm39) S473G probably benign Het
Fbxl2 A T 9: 113,832,239 (GRCm39) F58L probably damaging Het
Fmo6 T C 1: 162,750,241 (GRCm39) M272V probably benign Het
Gm10000 T C 12: 104,442,859 (GRCm39) probably benign Het
Grik1 T A 16: 87,746,956 (GRCm39) D442V probably damaging Het
Hectd1 A G 12: 51,791,375 (GRCm39) Y2588H probably damaging Het
Insrr A C 3: 87,711,369 (GRCm39) T430P probably benign Het
Lrch4 A G 5: 137,636,723 (GRCm39) T463A probably benign Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Lyst T G 13: 13,835,746 (GRCm39) F1809L probably damaging Het
Mad2l1bp A G 17: 46,463,770 (GRCm39) Y85H possibly damaging Het
Magoh G T 4: 107,740,362 (GRCm39) R82L probably benign Het
Mdfic2 A C 6: 98,215,100 (GRCm39) S174R probably damaging Het
Mlh1 A G 9: 111,057,543 (GRCm39) V756A probably damaging Het
Mlh3 T C 12: 85,313,915 (GRCm39) E757G probably damaging Het
Mycbp2 T C 14: 103,464,947 (GRCm39) T1339A probably damaging Het
Myh7b A T 2: 155,455,113 (GRCm39) E46V probably damaging Het
Naalad2 T A 9: 18,238,683 (GRCm39) R677S probably damaging Het
Nadsyn1 G A 7: 143,361,749 (GRCm39) T324I probably benign Het
Neo1 A T 9: 58,787,886 (GRCm39) L1389Q probably damaging Het
Nlrp1b A G 11: 71,107,681 (GRCm39) probably null Het
Nup210 A C 6: 91,039,785 (GRCm39) I690S probably benign Het
Or55b3 A T 7: 102,126,547 (GRCm39) S177T probably benign Het
Or5an11 T A 19: 12,246,281 (GRCm39) I229N probably damaging Het
Or9r7 T A 10: 129,962,123 (GRCm39) I268F possibly damaging Het
Otud7a C A 7: 63,383,458 (GRCm39) H316N probably damaging Het
Pcdh15 T C 10: 74,429,995 (GRCm39) S1241P probably damaging Het
Pclo A G 5: 14,570,977 (GRCm39) K121E probably damaging Het
Pcmtd1 A T 1: 7,217,872 (GRCm39) I107L probably benign Het
Pde6c A G 19: 38,168,673 (GRCm39) I755V probably damaging Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,927,719 (GRCm39) probably benign Het
Pi4ka A T 16: 17,113,240 (GRCm39) I1532N probably damaging Het
Pla2r1 A G 2: 60,271,428 (GRCm39) probably null Het
Plb1 A G 5: 32,474,621 (GRCm39) N661S probably null Het
Plekhd1 A G 12: 80,769,095 (GRCm39) K452E possibly damaging Het
Prr12 C A 7: 44,678,003 (GRCm39) V2003F unknown Het
Ptger1 G A 8: 84,395,107 (GRCm39) G195R probably benign Het
Ptpn4 T C 1: 119,711,240 (GRCm39) Q67R probably damaging Het
Rgsl1 C T 1: 153,680,422 (GRCm39) R760H probably damaging Het
Rock1 A G 18: 10,136,094 (GRCm39) probably null Het
Rtn1 T C 12: 72,270,298 (GRCm39) Y71C probably damaging Het
Rtp4 T C 16: 23,431,870 (GRCm39) *62Q probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,026,745 (GRCm39) probably benign Het
Scimp G T 11: 70,684,618 (GRCm39) P78H probably damaging Het
Scn8a C A 15: 100,853,409 (GRCm39) S132* probably null Het
Set A G 2: 29,959,436 (GRCm39) I124M probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Sgce A G 6: 4,689,709 (GRCm39) S375P probably damaging Het
Slc4a1ap G C 5: 31,701,098 (GRCm39) E600Q probably damaging Het
Slit1 A G 19: 41,626,031 (GRCm39) V577A possibly damaging Het
Sqstm1 A G 11: 50,098,307 (GRCm39) V153A probably benign Het
Src A G 2: 157,311,675 (GRCm39) M468V possibly damaging Het
Srrm3 A G 5: 135,902,079 (GRCm39) probably benign Het
Stk11ip C T 1: 75,504,030 (GRCm39) R257W probably damaging Het
Tfrc T A 16: 32,433,443 (GRCm39) D32E probably damaging Het
Tor1aip2 A T 1: 155,941,031 (GRCm39) I446L probably benign Het
Trmt11 T C 10: 30,411,221 (GRCm39) H424R probably benign Het
Urb1 A G 16: 90,563,928 (GRCm39) Y1612H probably benign Het
Vcan A T 13: 89,836,602 (GRCm39) S2981T probably damaging Het
Vdac1 G C 11: 52,265,190 (GRCm39) G21A probably damaging Het
Vmn2r76 A G 7: 85,879,356 (GRCm39) S315P probably benign Het
Xpo1 A G 11: 23,231,399 (GRCm39) T328A probably benign Het
Xrcc5 C T 1: 72,358,255 (GRCm39) L197F possibly damaging Het
Zfhx2 G C 14: 55,311,401 (GRCm39) S431C possibly damaging Het
Zfp410 C T 12: 84,372,494 (GRCm39) P54S probably benign Het
Zfp560 C A 9: 20,259,282 (GRCm39) G527* probably null Het
Zfp775 A G 6: 48,596,389 (GRCm39) T88A possibly damaging Het
Zfp780b T A 7: 27,663,808 (GRCm39) H249L possibly damaging Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7,567,330 (GRCm39) missense probably damaging 0.99
IGL00595:Lats1 APN 10 7,578,069 (GRCm39) missense probably benign 0.00
IGL00932:Lats1 APN 10 7,588,506 (GRCm39) missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7,581,435 (GRCm39) missense probably damaging 1.00
IGL01380:Lats1 APN 10 7,567,544 (GRCm39) missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7,577,470 (GRCm39) missense probably benign 0.10
IGL02027:Lats1 APN 10 7,588,712 (GRCm39) missense probably benign
IGL02611:Lats1 APN 10 7,581,551 (GRCm39) missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7,578,018 (GRCm39) missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7,588,510 (GRCm39) missense probably benign 0.15
I1329:Lats1 UTSW 10 7,588,566 (GRCm39) missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7,581,369 (GRCm39) missense probably damaging 1.00
R0153:Lats1 UTSW 10 7,567,339 (GRCm39) missense probably damaging 1.00
R0568:Lats1 UTSW 10 7,588,292 (GRCm39) missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7,578,705 (GRCm39) missense possibly damaging 0.67
R0604:Lats1 UTSW 10 7,588,425 (GRCm39) missense probably damaging 0.96
R1681:Lats1 UTSW 10 7,581,678 (GRCm39) missense probably damaging 0.99
R1840:Lats1 UTSW 10 7,586,703 (GRCm39) nonsense probably null
R1914:Lats1 UTSW 10 7,586,221 (GRCm39) splice site probably benign
R2137:Lats1 UTSW 10 7,577,611 (GRCm39) missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7,567,540 (GRCm39) nonsense probably null
R3863:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R3864:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R4597:Lats1 UTSW 10 7,567,510 (GRCm39) missense probably benign 0.00
R4657:Lats1 UTSW 10 7,581,448 (GRCm39) missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7,578,493 (GRCm39) missense probably benign
R4663:Lats1 UTSW 10 7,588,347 (GRCm39) missense probably damaging 1.00
R4870:Lats1 UTSW 10 7,581,549 (GRCm39) missense probably damaging 1.00
R5101:Lats1 UTSW 10 7,588,348 (GRCm39) nonsense probably null
R5134:Lats1 UTSW 10 7,567,575 (GRCm39) missense probably benign 0.34
R5150:Lats1 UTSW 10 7,588,415 (GRCm39) missense probably benign
R5546:Lats1 UTSW 10 7,581,518 (GRCm39) missense probably damaging 0.99
R5820:Lats1 UTSW 10 7,581,672 (GRCm39) missense probably damaging 1.00
R6006:Lats1 UTSW 10 7,581,359 (GRCm39) missense probably damaging 1.00
R6301:Lats1 UTSW 10 7,578,871 (GRCm39) missense probably benign 0.01
R6544:Lats1 UTSW 10 7,577,434 (GRCm39) missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7,573,271 (GRCm39) missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7,586,615 (GRCm39) missense probably damaging 1.00
R7328:Lats1 UTSW 10 7,581,311 (GRCm39) missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7,577,859 (GRCm39) nonsense probably null
R7438:Lats1 UTSW 10 7,588,706 (GRCm39) nonsense probably null
R7457:Lats1 UTSW 10 7,586,655 (GRCm39) missense probably damaging 1.00
R7524:Lats1 UTSW 10 7,577,742 (GRCm39) missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7,577,476 (GRCm39) missense probably damaging 1.00
R7736:Lats1 UTSW 10 7,578,128 (GRCm39) missense probably damaging 1.00
R7884:Lats1 UTSW 10 7,573,290 (GRCm39) nonsense probably null
R8166:Lats1 UTSW 10 7,577,880 (GRCm39) missense probably benign
R8248:Lats1 UTSW 10 7,581,667 (GRCm39) missense probably damaging 1.00
R8458:Lats1 UTSW 10 7,586,688 (GRCm39) nonsense probably null
R8477:Lats1 UTSW 10 7,581,279 (GRCm39) missense probably damaging 1.00
R8547:Lats1 UTSW 10 7,588,613 (GRCm39) missense probably damaging 1.00
R9163:Lats1 UTSW 10 7,578,052 (GRCm39) missense probably benign
R9441:Lats1 UTSW 10 7,578,681 (GRCm39) missense probably damaging 0.96
R9673:Lats1 UTSW 10 7,588,387 (GRCm39) missense probably benign 0.29
RF021:Lats1 UTSW 10 7,586,372 (GRCm39) missense probably damaging 1.00
X0026:Lats1 UTSW 10 7,586,387 (GRCm39) missense probably damaging 1.00
X0053:Lats1 UTSW 10 7,567,373 (GRCm39) missense probably benign 0.00
Z1176:Lats1 UTSW 10 7,581,573 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGCATTTGCTCAAGCTCAC -3'
(R):5'- AAAGCAGAGGGGCTTTGTCCATTAG -3'

Sequencing Primer
(F):5'- TTTGCTCAAGCTCACCCAAG -3'
(R):5'- ACCATTCTGAACTCCAGGTCG -3'
Posted On 2014-05-14