Incidental Mutation 'R1694:Brca1'
ID192044
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 039727-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1694 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101532099 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 74 (E74G)
Ref Sequence ENSEMBL: ENSMUSP00000139599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000190862]
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: E121G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: E121G

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190862
AA Change: E74G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139599
Gene: ENSMUSG00000017146
AA Change: E74G

DomainStartEndE-ValueType
SCOP:d1jm7a_ 1 56 1e-6 SMART
PDB:1JM7|A 1 63 1e-30 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T C 10: 120,778,628 probably benign Het
4930447C04Rik C T 12: 72,885,218 probably null Het
Abca16 A G 7: 120,520,084 H1017R probably damaging Het
Actl11 A G 9: 107,930,008 Y510C probably damaging Het
Agbl2 A G 2: 90,801,320 T341A probably damaging Het
Agbl5 A G 5: 30,893,382 Y458C probably damaging Het
Akap5 C T 12: 76,329,924 S710L probably damaging Het
Akr1c21 A G 13: 4,575,178 E36G probably damaging Het
Arhgap44 A G 11: 65,053,197 S163P probably damaging Het
Armc1 A G 3: 19,134,886 V205A possibly damaging Het
Asph A G 4: 9,610,869 L102P probably damaging Het
Brms1l A G 12: 55,841,600 R58G probably damaging Het
C1qbp G T 11: 70,978,247 probably null Het
Calcrl A T 2: 84,339,287 L350H probably damaging Het
Casr A T 16: 36,495,591 F706I probably damaging Het
Ceacam10 T A 7: 24,781,066 N87K probably benign Het
Cfap206 G T 4: 34,719,058 T316K probably damaging Het
Col4a3 A T 1: 82,690,663 probably null Het
Comtd1 A G 14: 21,847,330 V183A probably damaging Het
Crygs A T 16: 22,806,675 probably null Het
Dact1 C A 12: 71,312,777 T139K probably damaging Het
Dlx6 T C 6: 6,867,173 W259R probably damaging Het
Dnah9 G T 11: 65,954,824 S627* probably null Het
Dnajc11 T A 4: 151,979,273 V442D probably damaging Het
Dnajc21 A T 15: 10,451,563 S393T probably benign Het
Dpysl3 C A 18: 43,328,374 C584F possibly damaging Het
Efcab14 A G 4: 115,746,539 K138R possibly damaging Het
Ephb3 A G 16: 21,221,745 E577G probably damaging Het
Exoc3 C T 13: 74,190,065 probably null Het
Fam171a1 A G 2: 3,225,623 S473G probably benign Het
Fbxl2 A T 9: 114,003,171 F58L probably damaging Het
Fmo6 T C 1: 162,922,672 M272V probably benign Het
Gm1000 T C 12: 104,476,600 probably benign Het
Gm765 A C 6: 98,238,139 S174R probably damaging Het
Grik1 T A 16: 87,950,068 D442V probably damaging Het
Hectd1 A G 12: 51,744,592 Y2588H probably damaging Het
Insrr A C 3: 87,804,062 T430P probably benign Het
Lats1 T C 10: 7,701,945 S278P probably benign Het
Lrch4 A G 5: 137,638,461 T463A probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Lyst T G 13: 13,661,161 F1809L probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Magoh G T 4: 107,883,165 R82L probably benign Het
Mlh1 A G 9: 111,228,475 V756A probably damaging Het
Mlh3 T C 12: 85,267,141 E757G probably damaging Het
Mycbp2 T C 14: 103,227,511 T1339A probably damaging Het
Myh7b A T 2: 155,613,193 E46V probably damaging Het
Naalad2 T A 9: 18,327,387 R677S probably damaging Het
Nadsyn1 G A 7: 143,808,012 T324I probably benign Het
Neo1 A T 9: 58,880,603 L1389Q probably damaging Het
Nlrp1b A G 11: 71,216,855 probably null Het
Nup210 A C 6: 91,062,803 I690S probably benign Het
Olfr235 T A 19: 12,268,917 I229N probably damaging Het
Olfr543 A T 7: 102,477,340 S177T probably benign Het
Olfr824 T A 10: 130,126,254 I268F possibly damaging Het
Otud7a C A 7: 63,733,710 H316N probably damaging Het
Pcdh15 T C 10: 74,594,163 S1241P probably damaging Het
Pclo A G 5: 14,520,963 K121E probably damaging Het
Pcmtd1 A T 1: 7,147,648 I107L probably benign Het
Pde6c A G 19: 38,180,225 I755V probably damaging Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Pi4ka A T 16: 17,295,376 I1532N probably damaging Het
Pla2r1 A G 2: 60,441,084 probably null Het
Plb1 A G 5: 32,317,277 N661S probably null Het
Plekhd1 A G 12: 80,722,321 K452E possibly damaging Het
Prr12 C A 7: 45,028,579 V2003F unknown Het
Ptger1 G A 8: 83,668,478 G195R probably benign Het
Ptpn4 T C 1: 119,783,510 Q67R probably damaging Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rock1 A G 18: 10,136,094 probably null Het
Rtn1 T C 12: 72,223,524 Y71C probably damaging Het
Rtp4 T C 16: 23,613,120 *62Q probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scimp G T 11: 70,793,792 P78H probably damaging Het
Scn8a C A 15: 100,955,528 S132* probably null Het
Set A G 2: 30,069,424 I124M probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sgce A G 6: 4,689,709 S375P probably damaging Het
Slc4a1ap G C 5: 31,543,754 E600Q probably damaging Het
Slit1 A G 19: 41,637,592 V577A possibly damaging Het
Sqstm1 A G 11: 50,207,480 V153A probably benign Het
Src A G 2: 157,469,755 M468V possibly damaging Het
Srrm3 A G 5: 135,873,225 probably benign Het
Stk11ip C T 1: 75,527,386 R257W probably damaging Het
Tfrc T A 16: 32,614,625 D32E probably damaging Het
Tor1aip2 A T 1: 156,065,285 I446L probably benign Het
Trmt11 T C 10: 30,535,225 H424R probably benign Het
Urb1 A G 16: 90,767,040 Y1612H probably benign Het
Vcan A T 13: 89,688,483 S2981T probably damaging Het
Vdac1 G C 11: 52,374,363 G21A probably damaging Het
Vmn2r76 A G 7: 86,230,148 S315P probably benign Het
Xpo1 A G 11: 23,281,399 T328A probably benign Het
Xrcc5 C T 1: 72,319,096 L197F possibly damaging Het
Zfhx2 G C 14: 55,073,944 S431C possibly damaging Het
Zfp410 C T 12: 84,325,720 P54S probably benign Het
Zfp560 C A 9: 20,347,986 G527* probably null Het
Zfp775 A G 6: 48,619,455 T88A possibly damaging Het
Zfp780b T A 7: 27,964,383 H249L possibly damaging Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACACCAGATCCCCTGACTTTCTGA -3'
(R):5'- ACGCCACCACCACTAGGCTTTT -3'

Sequencing Primer
(F):5'- ACTTATTAGAACACTTGTCCAGCC -3'
(R):5'- ACCACCACTAGGCTTTTTTTCC -3'
Posted On2014-05-14