Mutagenetix > Incidental Mutation

Incidental Mutation 'R1694:Dact1'

192047

Institutional Source

Beutler Lab

Gene Symbol

Dact1

Ensembl Gene

ENSMUSG00000044548

Gene Name

dishevelled-binding antagonist of beta-catenin 1

Synonyms

Frodo, Dapper1, Frodo1, THYEX3, Frd1

MMRRC Submission

039727-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71309884-71320107 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 71312777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 139 (T139K)

Ref Sequence

ENSEMBL: ENSMUSP00000117169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061273] [ENSMUST00000150639]

AlphaFold

Q8R4A3

Predicted Effect

probably damaging
Transcript: ENSMUST00000061273
AA Change: T139K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058943
Gene: ENSMUSG00000044548
AA Change: T139K

Domain	Start	End	E-Value	Type
Pfam:Dapper	39	206	4.1e-83	PFAM
Pfam:Dapper	204	778	7.8e-184	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132822

Predicted Effect

probably damaging
Transcript: ENSMUST00000150639
AA Change: T139K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000117169
Gene: ENSMUSG00000044548
AA Change: T139K

Domain	Start	End	E-Value	Type
Pfam:Dapper	39	815	1.4e-240	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this mRNA from xenopus embryos resulted in loss of notochord and head structures, and mice lacking this gene died shortly after birth from severe posterior malformations. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, abnormal embryogenesis, blind-ended colons, and abnormal renal/urinary system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513I03Rik	T	C	10: 120,778,628		probably benign	Het
4930447C04Rik	C	T	12: 72,885,218		probably null	Het
Abca16	A	G	7: 120,520,084	H1017R	probably damaging	Het
Actl11	A	G	9: 107,930,008	Y510C	probably damaging	Het
Agbl2	A	G	2: 90,801,320	T341A	probably damaging	Het
Agbl5	A	G	5: 30,893,382	Y458C	probably damaging	Het
Akap5	C	T	12: 76,329,924	S710L	probably damaging	Het
Akr1c21	A	G	13: 4,575,178	E36G	probably damaging	Het
Arhgap44	A	G	11: 65,053,197	S163P	probably damaging	Het
Armc1	A	G	3: 19,134,886	V205A	possibly damaging	Het
Asph	A	G	4: 9,610,869	L102P	probably damaging	Het
Brca1	T	C	11: 101,532,099	E74G	probably damaging	Het
Brms1l	A	G	12: 55,841,600	R58G	probably damaging	Het
C1qbp	G	T	11: 70,978,247		probably null	Het
Calcrl	A	T	2: 84,339,287	L350H	probably damaging	Het
Casr	A	T	16: 36,495,591	F706I	probably damaging	Het
Ceacam10	T	A	7: 24,781,066	N87K	probably benign	Het
Cfap206	G	T	4: 34,719,058	T316K	probably damaging	Het
Col4a3	A	T	1: 82,690,663		probably null	Het
Comtd1	A	G	14: 21,847,330	V183A	probably damaging	Het
Crygs	A	T	16: 22,806,675		probably null	Het
Dlx6	T	C	6: 6,867,173	W259R	probably damaging	Het
Dnah9	G	T	11: 65,954,824	S627*	probably null	Het
Dnajc11	T	A	4: 151,979,273	V442D	probably damaging	Het
Dnajc21	A	T	15: 10,451,563	S393T	probably benign	Het
Dpysl3	C	A	18: 43,328,374	C584F	possibly damaging	Het
Efcab14	A	G	4: 115,746,539	K138R	possibly damaging	Het
Ephb3	A	G	16: 21,221,745	E577G	probably damaging	Het
Exoc3	C	T	13: 74,190,065		probably null	Het
Fam171a1	A	G	2: 3,225,623	S473G	probably benign	Het
Fbxl2	A	T	9: 114,003,171	F58L	probably damaging	Het
Fmo6	T	C	1: 162,922,672	M272V	probably benign	Het
Gm1000	T	C	12: 104,476,600		probably benign	Het
Gm765	A	C	6: 98,238,139	S174R	probably damaging	Het
Grik1	T	A	16: 87,950,068	D442V	probably damaging	Het
Hectd1	A	G	12: 51,744,592	Y2588H	probably damaging	Het
Insrr	A	C	3: 87,804,062	T430P	probably benign	Het
Lats1	T	C	10: 7,701,945	S278P	probably benign	Het
Lrch4	A	G	5: 137,638,461	T463A	probably benign	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Lyst	T	G	13: 13,661,161	F1809L	probably damaging	Het
Mad2l1bp	A	G	17: 46,152,844	Y85H	possibly damaging	Het
Magoh	G	T	4: 107,883,165	R82L	probably benign	Het
Mlh1	A	G	9: 111,228,475	V756A	probably damaging	Het
Mlh3	T	C	12: 85,267,141	E757G	probably damaging	Het
Mycbp2	T	C	14: 103,227,511	T1339A	probably damaging	Het
Myh7b	A	T	2: 155,613,193	E46V	probably damaging	Het
Naalad2	T	A	9: 18,327,387	R677S	probably damaging	Het
Nadsyn1	G	A	7: 143,808,012	T324I	probably benign	Het
Neo1	A	T	9: 58,880,603	L1389Q	probably damaging	Het
Nlrp1b	A	G	11: 71,216,855		probably null	Het
Nup210	A	C	6: 91,062,803	I690S	probably benign	Het
Olfr235	T	A	19: 12,268,917	I229N	probably damaging	Het
Olfr543	A	T	7: 102,477,340	S177T	probably benign	Het
Olfr824	T	A	10: 130,126,254	I268F	possibly damaging	Het
Otud7a	C	A	7: 63,733,710	H316N	probably damaging	Het
Pcdh15	T	C	10: 74,594,163	S1241P	probably damaging	Het
Pclo	A	G	5: 14,520,963	K121E	probably damaging	Het
Pcmtd1	A	T	1: 7,147,648	I107L	probably benign	Het
Pde6c	A	G	19: 38,180,225	I755V	probably damaging	Het
Pes1	CGGAGGAGGAGGAGGAGGAGGAGG	CGGAGGAGGAGGAGGAGGAGG	11: 3,977,719		probably benign	Het
Pi4ka	A	T	16: 17,295,376	I1532N	probably damaging	Het
Pla2r1	A	G	2: 60,441,084		probably null	Het
Plb1	A	G	5: 32,317,277	N661S	probably null	Het
Plekhd1	A	G	12: 80,722,321	K452E	possibly damaging	Het
Prr12	C	A	7: 45,028,579	V2003F	unknown	Het
Ptger1	G	A	8: 83,668,478	G195R	probably benign	Het
Ptpn4	T	C	1: 119,783,510	Q67R	probably damaging	Het
Rgsl1	C	T	1: 153,804,676	R760H	probably damaging	Het
Rock1	A	G	18: 10,136,094		probably null	Het
Rtn1	T	C	12: 72,223,524	Y71C	probably damaging	Het
Rtp4	T	C	16: 23,613,120	*62Q	probably null	Het
Scaf4	GGCTGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTGCTG	16: 90,229,857		probably benign	Het
Scimp	G	T	11: 70,793,792	P78H	probably damaging	Het
Scn8a	C	A	15: 100,955,528	S132*	probably null	Het
Set	A	G	2: 30,069,424	I124M	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sgce	A	G	6: 4,689,709	S375P	probably damaging	Het
Slc4a1ap	G	C	5: 31,543,754	E600Q	probably damaging	Het
Slit1	A	G	19: 41,637,592	V577A	possibly damaging	Het
Sqstm1	A	G	11: 50,207,480	V153A	probably benign	Het
Src	A	G	2: 157,469,755	M468V	possibly damaging	Het
Srrm3	A	G	5: 135,873,225		probably benign	Het
Stk11ip	C	T	1: 75,527,386	R257W	probably damaging	Het
Tfrc	T	A	16: 32,614,625	D32E	probably damaging	Het
Tor1aip2	A	T	1: 156,065,285	I446L	probably benign	Het
Trmt11	T	C	10: 30,535,225	H424R	probably benign	Het
Urb1	A	G	16: 90,767,040	Y1612H	probably benign	Het
Vcan	A	T	13: 89,688,483	S2981T	probably damaging	Het
Vdac1	G	C	11: 52,374,363	G21A	probably damaging	Het
Vmn2r76	A	G	7: 86,230,148	S315P	probably benign	Het
Xpo1	A	G	11: 23,281,399	T328A	probably benign	Het
Xrcc5	C	T	1: 72,319,096	L197F	possibly damaging	Het
Zfhx2	G	C	14: 55,073,944	S431C	possibly damaging	Het
Zfp410	C	T	12: 84,325,720	P54S	probably benign	Het
Zfp560	C	A	9: 20,347,986	G527*	probably null	Het
Zfp775	A	G	6: 48,619,455	T88A	possibly damaging	Het
Zfp780b	T	A	7: 27,964,383	H249L	possibly damaging	Het

Other mutations in Dact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03268:Dact1	APN	12	71317483	missense	probably damaging	1.00
R0930:Dact1	UTSW	12	71318460	missense	probably damaging	1.00
R1590:Dact1	UTSW	12	71317575	missense	probably benign	0.34
R1669:Dact1	UTSW	12	71318773	missense	probably damaging	1.00
R1826:Dact1	UTSW	12	71318344	missense	probably damaging	1.00
R4398:Dact1	UTSW	12	71317185	missense	probably damaging	1.00
R5028:Dact1	UTSW	12	71318573	nonsense	probably null
R5917:Dact1	UTSW	12	71318682	missense	possibly damaging	0.75
R6432:Dact1	UTSW	12	71318553	missense	probably damaging	1.00
R6473:Dact1	UTSW	12	71317698	missense	probably benign	0.00
R6759:Dact1	UTSW	12	71318137	nonsense	probably null
R6823:Dact1	UTSW	12	71317939	missense	probably benign	0.10
R7564:Dact1	UTSW	12	71318551	missense	probably damaging	1.00
R7776:Dact1	UTSW	12	71317914	missense	probably benign
R9046:Dact1	UTSW	12	71318760	missense	probably benign	0.38
R9581:Dact1	UTSW	12	71318845	missense	probably damaging	1.00
R9582:Dact1	UTSW	12	71318845	missense	probably damaging	1.00
X0025:Dact1	UTSW	12	71317852	missense	probably damaging	1.00
Z1177:Dact1	UTSW	12	71310051	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GGCCATGCCTCACCTTCTGATTATG -3'
(R):5'- TCAAGGATCACTGGGCAGCTCAAC -3'

Sequencing Primer
(F):5'- CACCTTCTGATTATGCAGTAGC -3'
(R):5'- GGCAGCTCAACCCCATTATTG -3'

Posted On

2014-05-14