Mutagenetix > Incidental Mutations

Incidental Mutation 'R1694:Ephb3'

192070

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

MMRRC Submission

039727-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.911) question?

Stock #

R1694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21221745 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 577 (E577G)

Ref Sequence

ENSEMBL: ENSMUSP00000124375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]

AlphaFold

P54754

Predicted Effect

probably damaging
Transcript: ENSMUST00000006112
AA Change: E831G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: E831G

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160053

Predicted Effect

probably damaging
Transcript: ENSMUST00000161063
AA Change: E577G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513I03Rik	T	C	10: 120,778,628		probably benign	Het
4930447C04Rik	C	T	12: 72,885,218		probably null	Het
Abca16	A	G	7: 120,520,084	H1017R	probably damaging	Het
Actl11	A	G	9: 107,930,008	Y510C	probably damaging	Het
Agbl2	A	G	2: 90,801,320	T341A	probably damaging	Het
Agbl5	A	G	5: 30,893,382	Y458C	probably damaging	Het
Akap5	C	T	12: 76,329,924	S710L	probably damaging	Het
Akr1c21	A	G	13: 4,575,178	E36G	probably damaging	Het
Arhgap44	A	G	11: 65,053,197	S163P	probably damaging	Het
Armc1	A	G	3: 19,134,886	V205A	possibly damaging	Het
Asph	A	G	4: 9,610,869	L102P	probably damaging	Het
Brca1	T	C	11: 101,532,099	E74G	probably damaging	Het
Brms1l	A	G	12: 55,841,600	R58G	probably damaging	Het
C1qbp	G	T	11: 70,978,247		probably null	Het
Calcrl	A	T	2: 84,339,287	L350H	probably damaging	Het
Casr	A	T	16: 36,495,591	F706I	probably damaging	Het
Ceacam10	T	A	7: 24,781,066	N87K	probably benign	Het
Cfap206	G	T	4: 34,719,058	T316K	probably damaging	Het
Col4a3	A	T	1: 82,690,663		probably null	Het
Comtd1	A	G	14: 21,847,330	V183A	probably damaging	Het
Crygs	A	T	16: 22,806,675		probably null	Het
Dact1	C	A	12: 71,312,777	T139K	probably damaging	Het
Dlx6	T	C	6: 6,867,173	W259R	probably damaging	Het
Dnah9	G	T	11: 65,954,824	S627*	probably null	Het
Dnajc11	T	A	4: 151,979,273	V442D	probably damaging	Het
Dnajc21	A	T	15: 10,451,563	S393T	probably benign	Het
Dpysl3	C	A	18: 43,328,374	C584F	possibly damaging	Het
Efcab14	A	G	4: 115,746,539	K138R	possibly damaging	Het
Exoc3	C	T	13: 74,190,065		probably null	Het
Fam171a1	A	G	2: 3,225,623	S473G	probably benign	Het
Fbxl2	A	T	9: 114,003,171	F58L	probably damaging	Het
Fmo6	T	C	1: 162,922,672	M272V	probably benign	Het
Gm1000	T	C	12: 104,476,600		probably benign	Het
Gm765	A	C	6: 98,238,139	S174R	probably damaging	Het
Grik1	T	A	16: 87,950,068	D442V	probably damaging	Het
Hectd1	A	G	12: 51,744,592	Y2588H	probably damaging	Het
Insrr	A	C	3: 87,804,062	T430P	probably benign	Het
Lats1	T	C	10: 7,701,945	S278P	probably benign	Het
Lrch4	A	G	5: 137,638,461	T463A	probably benign	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Lyst	T	G	13: 13,661,161	F1809L	probably damaging	Het
Mad2l1bp	A	G	17: 46,152,844	Y85H	possibly damaging	Het
Magoh	G	T	4: 107,883,165	R82L	probably benign	Het
Mlh1	A	G	9: 111,228,475	V756A	probably damaging	Het
Mlh3	T	C	12: 85,267,141	E757G	probably damaging	Het
Mycbp2	T	C	14: 103,227,511	T1339A	probably damaging	Het
Myh7b	A	T	2: 155,613,193	E46V	probably damaging	Het
Naalad2	T	A	9: 18,327,387	R677S	probably damaging	Het
Nadsyn1	G	A	7: 143,808,012	T324I	probably benign	Het
Neo1	A	T	9: 58,880,603	L1389Q	probably damaging	Het
Nlrp1b	A	G	11: 71,216,855		probably null	Het
Nup210	A	C	6: 91,062,803	I690S	probably benign	Het
Olfr235	T	A	19: 12,268,917	I229N	probably damaging	Het
Olfr543	A	T	7: 102,477,340	S177T	probably benign	Het
Olfr824	T	A	10: 130,126,254	I268F	possibly damaging	Het
Otud7a	C	A	7: 63,733,710	H316N	probably damaging	Het
Pcdh15	T	C	10: 74,594,163	S1241P	probably damaging	Het
Pclo	A	G	5: 14,520,963	K121E	probably damaging	Het
Pcmtd1	A	T	1: 7,147,648	I107L	probably benign	Het
Pde6c	A	G	19: 38,180,225	I755V	probably damaging	Het
Pes1	CGGAGGAGGAGGAGGAGGAGGAGG	CGGAGGAGGAGGAGGAGGAGG	11: 3,977,719		probably benign	Het
Pi4ka	A	T	16: 17,295,376	I1532N	probably damaging	Het
Pla2r1	A	G	2: 60,441,084		probably null	Het
Plb1	A	G	5: 32,317,277	N661S	probably null	Het
Plekhd1	A	G	12: 80,722,321	K452E	possibly damaging	Het
Prr12	C	A	7: 45,028,579	V2003F	unknown	Het
Ptger1	G	A	8: 83,668,478	G195R	probably benign	Het
Ptpn4	T	C	1: 119,783,510	Q67R	probably damaging	Het
Rgsl1	C	T	1: 153,804,676	R760H	probably damaging	Het
Rock1	A	G	18: 10,136,094		probably null	Het
Rtn1	T	C	12: 72,223,524	Y71C	probably damaging	Het
Rtp4	T	C	16: 23,613,120	*62Q	probably null	Het
Scaf4	GGCTGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTGCTG	16: 90,229,857		probably benign	Het
Scimp	G	T	11: 70,793,792	P78H	probably damaging	Het
Scn8a	C	A	15: 100,955,528	S132*	probably null	Het
Set	A	G	2: 30,069,424	I124M	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sgce	A	G	6: 4,689,709	S375P	probably damaging	Het
Slc4a1ap	G	C	5: 31,543,754	E600Q	probably damaging	Het
Slit1	A	G	19: 41,637,592	V577A	possibly damaging	Het
Sqstm1	A	G	11: 50,207,480	V153A	probably benign	Het
Src	A	G	2: 157,469,755	M468V	possibly damaging	Het
Srrm3	A	G	5: 135,873,225		probably benign	Het
Stk11ip	C	T	1: 75,527,386	R257W	probably damaging	Het
Tfrc	T	A	16: 32,614,625	D32E	probably damaging	Het
Tor1aip2	A	T	1: 156,065,285	I446L	probably benign	Het
Trmt11	T	C	10: 30,535,225	H424R	probably benign	Het
Urb1	A	G	16: 90,767,040	Y1612H	probably benign	Het
Vcan	A	T	13: 89,688,483	S2981T	probably damaging	Het
Vdac1	G	C	11: 52,374,363	G21A	probably damaging	Het
Vmn2r76	A	G	7: 86,230,148	S315P	probably benign	Het
Xpo1	A	G	11: 23,281,399	T328A	probably benign	Het
Xrcc5	C	T	1: 72,319,096	L197F	possibly damaging	Het
Zfhx2	G	C	14: 55,073,944	S431C	possibly damaging	Het
Zfp410	C	T	12: 84,325,720	P54S	probably benign	Het
Zfp560	C	A	9: 20,347,986	G527*	probably null	Het
Zfp775	A	G	6: 48,619,455	T88A	possibly damaging	Het
Zfp780b	T	A	7: 27,964,383	H249L	possibly damaging	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0196:Ephb3	UTSW	16	21218054	missense	probably damaging	1.00
R0230:Ephb3	UTSW	16	21220775	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R2378:Ephb3	UTSW	16	21218243	missense	probably benign
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4027:Ephb3	UTSW	16	21221697	missense	probably damaging	1.00
R4429:Ephb3	UTSW	16	21214463	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6020:Ephb3	UTSW	16	21222013	missense	probably damaging	0.99
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6539:Ephb3	UTSW	16	21221468	missense	probably benign
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R9092:Ephb3	UTSW	16	21222464	missense	probably benign	0.01
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- CAGGGTCATCGTTGAGTCACAAGG -3'
(R):5'- AGGATACTAACCCAGATGGGGCAC -3'

Sequencing Primer
(F):5'- AAGGTGAAGGGTACATTGTCCTC -3'
(R):5'- AGTCCAGCATGAGCTGGTG -3'

Posted On

2014-05-14