Incidental Mutation 'R1694:Urb1'
ID192078
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 039727-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1694 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90767040 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1612 (Y1612H)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140158
Predicted Effect probably benign
Transcript: ENSMUST00000140920
AA Change: Y1612H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: Y1612H

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T C 10: 120,778,628 probably benign Het
4930447C04Rik C T 12: 72,885,218 probably null Het
Abca16 A G 7: 120,520,084 H1017R probably damaging Het
Actl11 A G 9: 107,930,008 Y510C probably damaging Het
Agbl2 A G 2: 90,801,320 T341A probably damaging Het
Agbl5 A G 5: 30,893,382 Y458C probably damaging Het
Akap5 C T 12: 76,329,924 S710L probably damaging Het
Akr1c21 A G 13: 4,575,178 E36G probably damaging Het
Arhgap44 A G 11: 65,053,197 S163P probably damaging Het
Armc1 A G 3: 19,134,886 V205A possibly damaging Het
Asph A G 4: 9,610,869 L102P probably damaging Het
Brca1 T C 11: 101,532,099 E74G probably damaging Het
Brms1l A G 12: 55,841,600 R58G probably damaging Het
C1qbp G T 11: 70,978,247 probably null Het
Calcrl A T 2: 84,339,287 L350H probably damaging Het
Casr A T 16: 36,495,591 F706I probably damaging Het
Ceacam10 T A 7: 24,781,066 N87K probably benign Het
Cfap206 G T 4: 34,719,058 T316K probably damaging Het
Col4a3 A T 1: 82,690,663 probably null Het
Comtd1 A G 14: 21,847,330 V183A probably damaging Het
Crygs A T 16: 22,806,675 probably null Het
Dact1 C A 12: 71,312,777 T139K probably damaging Het
Dlx6 T C 6: 6,867,173 W259R probably damaging Het
Dnah9 G T 11: 65,954,824 S627* probably null Het
Dnajc11 T A 4: 151,979,273 V442D probably damaging Het
Dnajc21 A T 15: 10,451,563 S393T probably benign Het
Dpysl3 C A 18: 43,328,374 C584F possibly damaging Het
Efcab14 A G 4: 115,746,539 K138R possibly damaging Het
Ephb3 A G 16: 21,221,745 E577G probably damaging Het
Exoc3 C T 13: 74,190,065 probably null Het
Fam171a1 A G 2: 3,225,623 S473G probably benign Het
Fbxl2 A T 9: 114,003,171 F58L probably damaging Het
Fmo6 T C 1: 162,922,672 M272V probably benign Het
Gm1000 T C 12: 104,476,600 probably benign Het
Gm765 A C 6: 98,238,139 S174R probably damaging Het
Grik1 T A 16: 87,950,068 D442V probably damaging Het
Hectd1 A G 12: 51,744,592 Y2588H probably damaging Het
Insrr A C 3: 87,804,062 T430P probably benign Het
Lats1 T C 10: 7,701,945 S278P probably benign Het
Lrch4 A G 5: 137,638,461 T463A probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Lyst T G 13: 13,661,161 F1809L probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Magoh G T 4: 107,883,165 R82L probably benign Het
Mlh1 A G 9: 111,228,475 V756A probably damaging Het
Mlh3 T C 12: 85,267,141 E757G probably damaging Het
Mycbp2 T C 14: 103,227,511 T1339A probably damaging Het
Myh7b A T 2: 155,613,193 E46V probably damaging Het
Naalad2 T A 9: 18,327,387 R677S probably damaging Het
Nadsyn1 G A 7: 143,808,012 T324I probably benign Het
Neo1 A T 9: 58,880,603 L1389Q probably damaging Het
Nlrp1b A G 11: 71,216,855 probably null Het
Nup210 A C 6: 91,062,803 I690S probably benign Het
Olfr235 T A 19: 12,268,917 I229N probably damaging Het
Olfr543 A T 7: 102,477,340 S177T probably benign Het
Olfr824 T A 10: 130,126,254 I268F possibly damaging Het
Otud7a C A 7: 63,733,710 H316N probably damaging Het
Pcdh15 T C 10: 74,594,163 S1241P probably damaging Het
Pclo A G 5: 14,520,963 K121E probably damaging Het
Pcmtd1 A T 1: 7,147,648 I107L probably benign Het
Pde6c A G 19: 38,180,225 I755V probably damaging Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Pi4ka A T 16: 17,295,376 I1532N probably damaging Het
Pla2r1 A G 2: 60,441,084 probably null Het
Plb1 A G 5: 32,317,277 N661S probably null Het
Plekhd1 A G 12: 80,722,321 K452E possibly damaging Het
Prr12 C A 7: 45,028,579 V2003F unknown Het
Ptger1 G A 8: 83,668,478 G195R probably benign Het
Ptpn4 T C 1: 119,783,510 Q67R probably damaging Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rock1 A G 18: 10,136,094 probably null Het
Rtn1 T C 12: 72,223,524 Y71C probably damaging Het
Rtp4 T C 16: 23,613,120 *62Q probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scimp G T 11: 70,793,792 P78H probably damaging Het
Scn8a C A 15: 100,955,528 S132* probably null Het
Set A G 2: 30,069,424 I124M probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sgce A G 6: 4,689,709 S375P probably damaging Het
Slc4a1ap G C 5: 31,543,754 E600Q probably damaging Het
Slit1 A G 19: 41,637,592 V577A possibly damaging Het
Sqstm1 A G 11: 50,207,480 V153A probably benign Het
Src A G 2: 157,469,755 M468V possibly damaging Het
Srrm3 A G 5: 135,873,225 probably benign Het
Stk11ip C T 1: 75,527,386 R257W probably damaging Het
Tfrc T A 16: 32,614,625 D32E probably damaging Het
Tor1aip2 A T 1: 156,065,285 I446L probably benign Het
Trmt11 T C 10: 30,535,225 H424R probably benign Het
Vcan A T 13: 89,688,483 S2981T probably damaging Het
Vdac1 G C 11: 52,374,363 G21A probably damaging Het
Vmn2r76 A G 7: 86,230,148 S315P probably benign Het
Xpo1 A G 11: 23,281,399 T328A probably benign Het
Xrcc5 C T 1: 72,319,096 L197F possibly damaging Het
Zfhx2 G C 14: 55,073,944 S431C possibly damaging Het
Zfp410 C T 12: 84,325,720 P54S probably benign Het
Zfp560 C A 9: 20,347,986 G527* probably null Het
Zfp775 A G 6: 48,619,455 T88A possibly damaging Het
Zfp780b T A 7: 27,964,383 H249L possibly damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTGTGTCCTGAAACAATCCAAGCC -3'
(R):5'- AAATCCTGCAACCAGTCTGCTCTC -3'

Sequencing Primer
(F):5'- CACACGATAAGTCATCTTGTGGAG -3'
(R):5'- AGTCTGCTCTCCTGTCTGG -3'
Posted On2014-05-14