Incidental Mutation 'R1694:Pde6c'
ID192085
Institutional Source Beutler Lab
Gene Symbol Pde6c
Ensembl Gene ENSMUSG00000024992
Gene Namephosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonymscpfl1
MMRRC Submission 039727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1694 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38132781-38183958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38180225 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 755 (I755V)
Ref Sequence ENSEMBL: ENSMUSP00000107948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025956] [ENSMUST00000112329]
Predicted Effect probably damaging
Transcript: ENSMUST00000025956
AA Change: I780V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025956
Gene: ENSMUSG00000024992
AA Change: I780V

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 7.57e-9 SMART
low complexity region 827 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112329
AA Change: I755V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107948
Gene: ENSMUSG00000024992
AA Change: I755V

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 1.62e-8 SMART
low complexity region 802 811 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-prime subunit of cone phosphodiesterase, which is composed of a homodimer of two alpha-prime subunits and 3 smaller proteins of 11, 13, and 15 kDa. Mutations in this gene are associated with cone dystrophy type 4 (COD4). [provided by RefSeq, Mar 2010]
PHENOTYPE: A spontaneous mutation in this gene results in abnormal cone photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T C 10: 120,778,628 probably benign Het
4930447C04Rik C T 12: 72,885,218 probably null Het
Abca16 A G 7: 120,520,084 H1017R probably damaging Het
Actl11 A G 9: 107,930,008 Y510C probably damaging Het
Agbl2 A G 2: 90,801,320 T341A probably damaging Het
Agbl5 A G 5: 30,893,382 Y458C probably damaging Het
Akap5 C T 12: 76,329,924 S710L probably damaging Het
Akr1c21 A G 13: 4,575,178 E36G probably damaging Het
Arhgap44 A G 11: 65,053,197 S163P probably damaging Het
Armc1 A G 3: 19,134,886 V205A possibly damaging Het
Asph A G 4: 9,610,869 L102P probably damaging Het
Brca1 T C 11: 101,532,099 E74G probably damaging Het
Brms1l A G 12: 55,841,600 R58G probably damaging Het
C1qbp G T 11: 70,978,247 probably null Het
Calcrl A T 2: 84,339,287 L350H probably damaging Het
Casr A T 16: 36,495,591 F706I probably damaging Het
Ceacam10 T A 7: 24,781,066 N87K probably benign Het
Cfap206 G T 4: 34,719,058 T316K probably damaging Het
Col4a3 A T 1: 82,690,663 probably null Het
Comtd1 A G 14: 21,847,330 V183A probably damaging Het
Crygs A T 16: 22,806,675 probably null Het
Dact1 C A 12: 71,312,777 T139K probably damaging Het
Dlx6 T C 6: 6,867,173 W259R probably damaging Het
Dnah9 G T 11: 65,954,824 S627* probably null Het
Dnajc11 T A 4: 151,979,273 V442D probably damaging Het
Dnajc21 A T 15: 10,451,563 S393T probably benign Het
Dpysl3 C A 18: 43,328,374 C584F possibly damaging Het
Efcab14 A G 4: 115,746,539 K138R possibly damaging Het
Ephb3 A G 16: 21,221,745 E577G probably damaging Het
Exoc3 C T 13: 74,190,065 probably null Het
Fam171a1 A G 2: 3,225,623 S473G probably benign Het
Fbxl2 A T 9: 114,003,171 F58L probably damaging Het
Fmo6 T C 1: 162,922,672 M272V probably benign Het
Gm1000 T C 12: 104,476,600 probably benign Het
Gm765 A C 6: 98,238,139 S174R probably damaging Het
Grik1 T A 16: 87,950,068 D442V probably damaging Het
Hectd1 A G 12: 51,744,592 Y2588H probably damaging Het
Insrr A C 3: 87,804,062 T430P probably benign Het
Lats1 T C 10: 7,701,945 S278P probably benign Het
Lrch4 A G 5: 137,638,461 T463A probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Lyst T G 13: 13,661,161 F1809L probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Magoh G T 4: 107,883,165 R82L probably benign Het
Mlh1 A G 9: 111,228,475 V756A probably damaging Het
Mlh3 T C 12: 85,267,141 E757G probably damaging Het
Mycbp2 T C 14: 103,227,511 T1339A probably damaging Het
Myh7b A T 2: 155,613,193 E46V probably damaging Het
Naalad2 T A 9: 18,327,387 R677S probably damaging Het
Nadsyn1 G A 7: 143,808,012 T324I probably benign Het
Neo1 A T 9: 58,880,603 L1389Q probably damaging Het
Nlrp1b A G 11: 71,216,855 probably null Het
Nup210 A C 6: 91,062,803 I690S probably benign Het
Olfr235 T A 19: 12,268,917 I229N probably damaging Het
Olfr543 A T 7: 102,477,340 S177T probably benign Het
Olfr824 T A 10: 130,126,254 I268F possibly damaging Het
Otud7a C A 7: 63,733,710 H316N probably damaging Het
Pcdh15 T C 10: 74,594,163 S1241P probably damaging Het
Pclo A G 5: 14,520,963 K121E probably damaging Het
Pcmtd1 A T 1: 7,147,648 I107L probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Pi4ka A T 16: 17,295,376 I1532N probably damaging Het
Pla2r1 A G 2: 60,441,084 probably null Het
Plb1 A G 5: 32,317,277 N661S probably null Het
Plekhd1 A G 12: 80,722,321 K452E possibly damaging Het
Prr12 C A 7: 45,028,579 V2003F unknown Het
Ptger1 G A 8: 83,668,478 G195R probably benign Het
Ptpn4 T C 1: 119,783,510 Q67R probably damaging Het
Rgsl1 C T 1: 153,804,676 R760H probably damaging Het
Rock1 A G 18: 10,136,094 probably null Het
Rtn1 T C 12: 72,223,524 Y71C probably damaging Het
Rtp4 T C 16: 23,613,120 *62Q probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Scimp G T 11: 70,793,792 P78H probably damaging Het
Scn8a C A 15: 100,955,528 S132* probably null Het
Set A G 2: 30,069,424 I124M probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sgce A G 6: 4,689,709 S375P probably damaging Het
Slc4a1ap G C 5: 31,543,754 E600Q probably damaging Het
Slit1 A G 19: 41,637,592 V577A possibly damaging Het
Sqstm1 A G 11: 50,207,480 V153A probably benign Het
Src A G 2: 157,469,755 M468V possibly damaging Het
Srrm3 A G 5: 135,873,225 probably benign Het
Stk11ip C T 1: 75,527,386 R257W probably damaging Het
Tfrc T A 16: 32,614,625 D32E probably damaging Het
Tor1aip2 A T 1: 156,065,285 I446L probably benign Het
Trmt11 T C 10: 30,535,225 H424R probably benign Het
Urb1 A G 16: 90,767,040 Y1612H probably benign Het
Vcan A T 13: 89,688,483 S2981T probably damaging Het
Vdac1 G C 11: 52,374,363 G21A probably damaging Het
Vmn2r76 A G 7: 86,230,148 S315P probably benign Het
Xpo1 A G 11: 23,281,399 T328A probably benign Het
Xrcc5 C T 1: 72,319,096 L197F possibly damaging Het
Zfhx2 G C 14: 55,073,944 S431C possibly damaging Het
Zfp410 C T 12: 84,325,720 P54S probably benign Het
Zfp560 C A 9: 20,347,986 G527* probably null Het
Zfp775 A G 6: 48,619,455 T88A possibly damaging Het
Zfp780b T A 7: 27,964,383 H249L possibly damaging Het
Other mutations in Pde6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Pde6c APN 19 38162876 splice site probably benign
IGL01333:Pde6c APN 19 38175695 missense probably benign 0.05
IGL01390:Pde6c APN 19 38161928 missense probably benign 0.01
IGL02508:Pde6c APN 19 38157500 missense probably benign 0.13
IGL02542:Pde6c APN 19 38178130 missense probably damaging 1.00
IGL02546:Pde6c APN 19 38140040 missense probably benign 0.00
IGL02661:Pde6c APN 19 38180800 missense probably damaging 0.97
silverton UTSW 19 38162845 missense probably damaging 1.00
IGL03097:Pde6c UTSW 19 38178271 missense probably damaging 1.00
R0117:Pde6c UTSW 19 38151531 missense probably damaging 1.00
R0128:Pde6c UTSW 19 38169365 splice site probably benign
R0349:Pde6c UTSW 19 38162349 missense probably damaging 1.00
R0612:Pde6c UTSW 19 38133246 missense probably benign 0.03
R0692:Pde6c UTSW 19 38180250 missense probably damaging 0.99
R0785:Pde6c UTSW 19 38133180 missense probably benign
R1605:Pde6c UTSW 19 38141492 missense probably damaging 1.00
R1643:Pde6c UTSW 19 38161958 missense possibly damaging 0.56
R1781:Pde6c UTSW 19 38151698 missense possibly damaging 0.69
R1900:Pde6c UTSW 19 38161940 missense probably damaging 1.00
R1944:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R1945:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R2143:Pde6c UTSW 19 38162329 missense probably damaging 1.00
R2497:Pde6c UTSW 19 38153694 missense probably damaging 1.00
R3737:Pde6c UTSW 19 38140224 missense probably damaging 1.00
R4010:Pde6c UTSW 19 38169436 missense probably damaging 1.00
R4241:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4242:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4259:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4661:Pde6c UTSW 19 38169439 missense probably damaging 1.00
R4677:Pde6c UTSW 19 38157385 missense probably damaging 1.00
R4708:Pde6c UTSW 19 38180893 missense possibly damaging 0.92
R4889:Pde6c UTSW 19 38133151 missense probably benign 0.23
R4898:Pde6c UTSW 19 38150624 missense possibly damaging 0.81
R4941:Pde6c UTSW 19 38151565 missense probably damaging 1.00
R5448:Pde6c UTSW 19 38133175 missense probably damaging 1.00
R6174:Pde6c UTSW 19 38140229 missense possibly damaging 0.57
R6249:Pde6c UTSW 19 38158560 critical splice donor site probably null
R6270:Pde6c UTSW 19 38158436 missense probably damaging 1.00
R7183:Pde6c UTSW 19 38133090 missense probably benign 0.00
R7428:Pde6c UTSW 19 38157536 critical splice donor site probably null
R7429:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7430:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7643:Pde6c UTSW 19 38141421 missense probably damaging 1.00
R7793:Pde6c UTSW 19 38159753 missense possibly damaging 0.94
R7811:Pde6c UTSW 19 38140059 missense possibly damaging 0.91
R8097:Pde6c UTSW 19 38161966 nonsense probably null
Z1176:Pde6c UTSW 19 38132881 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGCAGCAACCAATTGTAAAGAC -3'
(R):5'- ACTCAGGGAGTGGGATGACCTAATG -3'

Sequencing Primer
(F):5'- GTAAAGACCCCTTCATCACTGTG -3'
(R):5'- gcctgaaacttagcatgtagtcc -3'
Posted On2014-05-14