Incidental Mutation 'R1695:Arpc2'
ID192089
Institutional Source Beutler Lab
Gene Symbol Arpc2
Ensembl Gene ENSMUSG00000006304
Gene Nameactin related protein 2/3 complex, subunit 2
Synonymsp34-Arc, 2210023N03Rik
MMRRC Submission 039728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1695 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74236084-74268209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74248232 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 70 (H70Q)
Ref Sequence ENSEMBL: ENSMUSP00000109451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006467] [ENSMUST00000113819] [ENSMUST00000113820]
Predicted Effect probably damaging
Transcript: ENSMUST00000006467
AA Change: H70Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006467
Gene: ENSMUSG00000006304
AA Change: H70Q

DomainStartEndE-ValueType
Pfam:P34-Arc 57 284 3.7e-107 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113819
AA Change: H54Q

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109450
Gene: ENSMUSG00000006304
AA Change: H54Q

DomainStartEndE-ValueType
Pfam:P34-Arc 40 270 4.3e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113820
AA Change: H70Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109451
Gene: ENSMUSG00000006304
AA Change: H70Q

DomainStartEndE-ValueType
Pfam:P34-Arc 56 286 4.2e-106 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p34 subunit, has yet to be determined. Two alternatively spliced variants have been characterized to date. Additional alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,874,644 D10E probably damaging Het
Adam1b T A 5: 121,500,907 T692S probably benign Het
Adgrf3 T A 5: 30,203,555 N75I probably benign Het
Adgrg5 A G 8: 94,937,745 M328V probably damaging Het
Adk A G 14: 21,381,600 D286G probably benign Het
Ankrd28 T A 14: 31,707,244 D917V probably damaging Het
Appl2 C T 10: 83,621,582 D141N probably damaging Het
Arfgef2 T C 2: 166,864,712 V952A probably damaging Het
Bpifa5 T C 2: 154,167,660 L261P probably damaging Het
Brca1 G T 11: 101,524,455 T951K probably damaging Het
Ccdc189 A G 7: 127,587,573 probably null Het
Ccdc73 A T 2: 104,992,105 S800C probably damaging Het
Cdh15 C G 8: 122,862,016 D276E probably benign Het
Cfh T C 1: 140,102,837 I551V probably damaging Het
Chd7 T A 4: 8,833,960 L1238Q probably damaging Het
Chd9 T G 8: 91,001,782 F1275L probably damaging Het
Chrnb3 A G 8: 27,393,700 Y155C probably damaging Het
Cltc C A 11: 86,701,060 probably null Het
Ctsll3 T A 13: 60,800,977 N55Y probably damaging Het
Cysltr2 T C 14: 73,029,881 M130V probably benign Het
Daglb T C 5: 143,494,606 M455T probably benign Het
Dbn1 A G 13: 55,476,708 S343P probably benign Het
Dnah2 T A 11: 69,514,691 D665V possibly damaging Het
Dusp6 T A 10: 99,263,693 M1K probably null Het
Eif3m T C 2: 105,016,953 E12G probably damaging Het
Epha2 T C 4: 141,306,517 V29A possibly damaging Het
Fam160b1 T C 19: 57,379,171 W337R probably damaging Het
Farp2 T A 1: 93,560,325 N91K probably damaging Het
Ferd3l C A 12: 33,928,972 S161R probably benign Het
Fgd2 A T 17: 29,368,245 D315V possibly damaging Het
Fstl4 T A 11: 53,165,878 probably null Het
Grm5 A G 7: 88,036,103 D476G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdlbp A G 1: 93,437,200 L115P probably damaging Het
Hk2 T A 6: 82,744,951 N136Y probably damaging Het
Hs2st1 G T 3: 144,434,654 A302E probably benign Het
Htr7 T C 19: 35,969,736 N293D probably benign Het
Ikbkb T A 8: 22,673,480 E271D probably benign Het
Il5ra A T 6: 106,738,374 Y166* probably null Het
Il9r T A 11: 32,193,227 H244L probably benign Het
Itih4 T C 14: 30,891,499 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Limk2 A G 11: 3,353,275 probably null Het
Med15 A G 16: 17,722,780 F34S probably damaging Het
Mprip C T 11: 59,752,531 T505I probably damaging Het
Mtor T A 4: 148,538,907 N2071K probably benign Het
Muc16 A G 9: 18,497,433 L2522P probably damaging Het
Myd88 A T 9: 119,337,842 probably null Het
Myo7a A C 7: 98,092,496 F484V possibly damaging Het
Nme1 A C 11: 93,960,767 L81R probably benign Het
Ntn4 T A 10: 93,733,602 probably null Het
Olfr1180 T C 2: 88,412,100 D186G probably damaging Het
Olfr1383 T C 11: 49,524,335 V204A probably benign Het
Olfr630 A T 7: 103,754,924 Y220* probably null Het
Otogl T G 10: 107,814,017 N1159T probably damaging Het
Pabpc6 G A 17: 9,668,074 T516I probably benign Het
Pcdh1 C T 18: 38,202,868 R238H probably damaging Het
Pex5l T A 3: 32,954,382 N151I probably benign Het
Plekha7 T C 7: 116,128,685 N980S probably damaging Het
Reg4 C T 3: 98,236,361 T157I probably benign Het
Rev3l A T 10: 39,824,616 E1703V probably damaging Het
Rev3l G T 10: 39,824,615 E1703* probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Saal1 T C 7: 46,692,916 K368E probably damaging Het
Scn9a C T 2: 66,504,876 W1245* probably null Het
Slc38a11 T A 2: 65,316,971 L387F probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sptb C A 12: 76,620,867 V819L probably benign Het
Sptbn1 T C 11: 30,136,124 T1195A probably benign Het
Ssna1 C A 2: 25,272,012 V57F possibly damaging Het
Stk32a G T 18: 43,313,420 E312* probably null Het
Synpo A G 18: 60,603,387 F496L probably benign Het
Syt15 C T 14: 34,222,901 T135M probably benign Het
Tm9sf4 A G 2: 153,190,912 E246G probably benign Het
Trim44 T C 2: 102,357,485 M308V possibly damaging Het
Unc119b T A 5: 115,134,826 K29* probably null Het
Vim T A 2: 13,580,110 D367E probably benign Het
Virma T A 4: 11,494,814 N38K probably damaging Het
Vmn1r228 A T 17: 20,776,298 D319E possibly damaging Het
Vmn2r32 T A 7: 7,463,992 I846F probably benign Het
Vps13b T C 15: 35,576,521 V1025A probably benign Het
Vps13c G T 9: 67,972,075 E566* probably null Het
Other mutations in Arpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Arpc2 APN 1 74248179 missense probably benign
R0220:Arpc2 UTSW 1 74248134 missense probably damaging 1.00
R0364:Arpc2 UTSW 1 74236887 missense probably null
R4183:Arpc2 UTSW 1 74248163 missense probably damaging 0.99
R5144:Arpc2 UTSW 1 74248208 missense probably damaging 1.00
R5438:Arpc2 UTSW 1 74236836 missense probably null 1.00
R5775:Arpc2 UTSW 1 74255949 splice site probably null
R6017:Arpc2 UTSW 1 74262486 missense probably benign
R7173:Arpc2 UTSW 1 74264372 missense probably damaging 1.00
R7683:Arpc2 UTSW 1 74263814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAGTACACTCTGAAAGAAGCCCC -3'
(R):5'- GAATGGAGTTGGAAGCCCCTGTTAG -3'

Sequencing Primer
(F):5'- CTGCATAGGTGGACTCTTTAATAGC -3'
(R):5'- CCCTGTTAGCTGTATAAAGAAGCC -3'
Posted On2014-05-14