Mutagenetix > Incidental Mutation

Incidental Mutation 'R1695:Adgrf3'

192115

Institutional Source

Beutler Lab

Gene Symbol

Adgrf3

Ensembl Gene

ENSMUSG00000067642

Gene Name

adhesion G protein-coupled receptor F3

Synonyms

Gpr113, LOC381628, PGR23

MMRRC Submission

039728-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30193431-30205722 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30203555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 75 (N75I)

Ref Sequence

ENSEMBL: ENSMUSP00000085440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088117]

AlphaFold

Q58Y75

Predicted Effect

probably benign
Transcript: ENSMUST00000088117
AA Change: N75I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: N75I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
low complexity region	403	415	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
GPS	632	684	2.68e-17	SMART
Pfam:7tm_2	687	935	1e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135322

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,874,644	D10E	probably damaging	Het
Adam1b	T	A	5: 121,500,907	T692S	probably benign	Het
Adgrg5	A	G	8: 94,937,745	M328V	probably damaging	Het
Adk	A	G	14: 21,381,600	D286G	probably benign	Het
Ankrd28	T	A	14: 31,707,244	D917V	probably damaging	Het
Appl2	C	T	10: 83,621,582	D141N	probably damaging	Het
Arfgef2	T	C	2: 166,864,712	V952A	probably damaging	Het
Arpc2	T	A	1: 74,248,232	H70Q	probably damaging	Het
Bpifa5	T	C	2: 154,167,660	L261P	probably damaging	Het
Brca1	G	T	11: 101,524,455	T951K	probably damaging	Het
Ccdc189	A	G	7: 127,587,573		probably null	Het
Ccdc73	A	T	2: 104,992,105	S800C	probably damaging	Het
Cdh15	C	G	8: 122,862,016	D276E	probably benign	Het
Cfh	T	C	1: 140,102,837	I551V	probably damaging	Het
Chd7	T	A	4: 8,833,960	L1238Q	probably damaging	Het
Chd9	T	G	8: 91,001,782	F1275L	probably damaging	Het
Chrnb3	A	G	8: 27,393,700	Y155C	probably damaging	Het
Cltc	C	A	11: 86,701,060		probably null	Het
Ctsll3	T	A	13: 60,800,977	N55Y	probably damaging	Het
Cysltr2	T	C	14: 73,029,881	M130V	probably benign	Het
Daglb	T	C	5: 143,494,606	M455T	probably benign	Het
Dbn1	A	G	13: 55,476,708	S343P	probably benign	Het
Dnah2	T	A	11: 69,514,691	D665V	possibly damaging	Het
Dusp6	T	A	10: 99,263,693	M1K	probably null	Het
Eif3m	T	C	2: 105,016,953	E12G	probably damaging	Het
Epha2	T	C	4: 141,306,517	V29A	possibly damaging	Het
Fam160b1	T	C	19: 57,379,171	W337R	probably damaging	Het
Farp2	T	A	1: 93,560,325	N91K	probably damaging	Het
Ferd3l	C	A	12: 33,928,972	S161R	probably benign	Het
Fgd2	A	T	17: 29,368,245	D315V	possibly damaging	Het
Fstl4	T	A	11: 53,165,878		probably null	Het
Grm5	A	G	7: 88,036,103	D476G	possibly damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdlbp	A	G	1: 93,437,200	L115P	probably damaging	Het
Hk2	T	A	6: 82,744,951	N136Y	probably damaging	Het
Hs2st1	G	T	3: 144,434,654	A302E	probably benign	Het
Htr7	T	C	19: 35,969,736	N293D	probably benign	Het
Ikbkb	T	A	8: 22,673,480	E271D	probably benign	Het
Il5ra	A	T	6: 106,738,374	Y166*	probably null	Het
Il9r	T	A	11: 32,193,227	H244L	probably benign	Het
Itih4	T	C	14: 30,891,499		probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Large1	A	T	8: 72,818,082	D689E	probably damaging	Het
Limk2	A	G	11: 3,353,275		probably null	Het
Med15	A	G	16: 17,722,780	F34S	probably damaging	Het
Mprip	C	T	11: 59,752,531	T505I	probably damaging	Het
Mtor	T	A	4: 148,538,907	N2071K	probably benign	Het
Muc16	A	G	9: 18,497,433	L2522P	probably damaging	Het
Myd88	A	T	9: 119,337,842		probably null	Het
Myo7a	A	C	7: 98,092,496	F484V	possibly damaging	Het
Nme1	A	C	11: 93,960,767	L81R	probably benign	Het
Ntn4	T	A	10: 93,733,602		probably null	Het
Olfr1180	T	C	2: 88,412,100	D186G	probably damaging	Het
Olfr1383	T	C	11: 49,524,335	V204A	probably benign	Het
Olfr630	A	T	7: 103,754,924	Y220*	probably null	Het
Otogl	T	G	10: 107,814,017	N1159T	probably damaging	Het
Pabpc6	G	A	17: 9,668,074	T516I	probably benign	Het
Pcdh1	C	T	18: 38,202,868	R238H	probably damaging	Het
Pex5l	T	A	3: 32,954,382	N151I	probably benign	Het
Plekha7	T	C	7: 116,128,685	N980S	probably damaging	Het
Reg4	C	T	3: 98,236,361	T157I	probably benign	Het
Rev3l	G	T	10: 39,824,615	E1703*	probably null	Het
Rev3l	A	T	10: 39,824,616	E1703V	probably damaging	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Saal1	T	C	7: 46,692,916	K368E	probably damaging	Het
Scn9a	C	T	2: 66,504,876	W1245*	probably null	Het
Slc38a11	T	A	2: 65,316,971	L387F	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sptb	C	A	12: 76,620,867	V819L	probably benign	Het
Sptbn1	T	C	11: 30,136,124	T1195A	probably benign	Het
Ssna1	C	A	2: 25,272,012	V57F	possibly damaging	Het
Stk32a	G	T	18: 43,313,420	E312*	probably null	Het
Synpo	A	G	18: 60,603,387	F496L	probably benign	Het
Syt15	C	T	14: 34,222,901	T135M	probably benign	Het
Tm9sf4	A	G	2: 153,190,912	E246G	probably benign	Het
Trim44	T	C	2: 102,357,485	M308V	possibly damaging	Het
Unc119b	T	A	5: 115,134,826	K29*	probably null	Het
Vim	T	A	2: 13,580,110	D367E	probably benign	Het
Virma	T	A	4: 11,494,814	N38K	probably damaging	Het
Vmn1r228	A	T	17: 20,776,298	D319E	possibly damaging	Het
Vmn2r32	T	A	7: 7,463,992	I846F	probably benign	Het
Vps13b	T	C	15: 35,576,521	V1025A	probably benign	Het
Vps13c	G	T	9: 67,972,075	E566*	probably null	Het

Other mutations in Adgrf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03080:Adgrf3	APN	5	30196829	missense	probably benign	0.02
IGL03171:Adgrf3	APN	5	30196294	missense	probably damaging	1.00
R0010:Adgrf3	UTSW	5	30205609	splice site	probably benign
R0042:Adgrf3	UTSW	5	30197428	missense	probably damaging	1.00
R0140:Adgrf3	UTSW	5	30196381	missense	probably benign	0.19
R0617:Adgrf3	UTSW	5	30195080	missense	probably benign	0.25
R0748:Adgrf3	UTSW	5	30196876	missense	probably damaging	1.00
R1291:Adgrf3	UTSW	5	30199534	missense	probably damaging	0.99
R1330:Adgrf3	UTSW	5	30195095	missense	probably benign	0.24
R1468:Adgrf3	UTSW	5	30202229	splice site	probably benign
R1716:Adgrf3	UTSW	5	30197551	missense	probably benign	0.03
R1844:Adgrf3	UTSW	5	30199213	missense	probably damaging	0.96
R1935:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R1936:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R2059:Adgrf3	UTSW	5	30199491	missense	possibly damaging	0.91
R2656:Adgrf3	UTSW	5	30196438	missense	possibly damaging	0.96
R2913:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2914:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2987:Adgrf3	UTSW	5	30197360	missense	probably damaging	1.00
R3797:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3798:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3799:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3934:Adgrf3	UTSW	5	30200434	unclassified	probably benign
R4043:Adgrf3	UTSW	5	30204362	missense	probably benign	0.00
R4080:Adgrf3	UTSW	5	30197369	nonsense	probably null
R4575:Adgrf3	UTSW	5	30202257	missense	probably benign	0.00
R4754:Adgrf3	UTSW	5	30197617	critical splice acceptor site	probably null
R4819:Adgrf3	UTSW	5	30198444	missense	possibly damaging	0.66
R4893:Adgrf3	UTSW	5	30200478	missense	probably benign	0.00
R4991:Adgrf3	UTSW	5	30199148	missense	probably benign	0.26
R5686:Adgrf3	UTSW	5	30197306	missense	probably damaging	1.00
R5965:Adgrf3	UTSW	5	30205639	missense	probably benign	0.00
R5997:Adgrf3	UTSW	5	30198362	critical splice donor site	probably null
R6103:Adgrf3	UTSW	5	30196267	missense	probably damaging	1.00
R6244:Adgrf3	UTSW	5	30197533	missense	probably benign	0.17
R6409:Adgrf3	UTSW	5	30197314	missense	probably damaging	0.96
R6575:Adgrf3	UTSW	5	30196524	missense	possibly damaging	0.72
R6745:Adgrf3	UTSW	5	30203603	missense	probably benign	0.31
R6790:Adgrf3	UTSW	5	30196387	missense	probably benign	0.00
R6813:Adgrf3	UTSW	5	30197521	missense	probably damaging	0.96
R7202:Adgrf3	UTSW	5	30204380	nonsense	probably null
R7250:Adgrf3	UTSW	5	30195682	missense	probably damaging	1.00
R7353:Adgrf3	UTSW	5	30198497	missense	probably damaging	0.98
R7634:Adgrf3	UTSW	5	30202247	missense	probably benign	0.01
R7658:Adgrf3	UTSW	5	30197206	missense	probably benign	0.41
R8037:Adgrf3	UTSW	5	30199512	missense	probably damaging	1.00
R8281:Adgrf3	UTSW	5	30197303	missense	possibly damaging	0.46
R8717:Adgrf3	UTSW	5	30198581	unclassified	probably benign
R8857:Adgrf3	UTSW	5	30197067	nonsense	probably null
R8926:Adgrf3	UTSW	5	30200448	missense	possibly damaging	0.46
R9391:Adgrf3	UTSW	5	30195073	missense	possibly damaging	0.94
R9446:Adgrf3	UTSW	5	30196959	missense	probably benign	0.01
R9522:Adgrf3	UTSW	5	30199484	missense	possibly damaging	0.90
Z1088:Adgrf3	UTSW	5	30199120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACACCCTCGTGAAGTTCCTCACTAC -3'
(R):5'- GAGATGACATCTGCTTGTGTCCCC -3'

Sequencing Primer
(F):5'- CTATCAGAACATTGGGACATGAAC -3'
(R):5'- GCTTGTGTCCCCGGAAATG -3'

Posted On

2014-05-14