Incidental Mutation 'R1695:Adgrf3'
ID192115
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Nameadhesion G protein-coupled receptor F3
SynonymsGpr113, LOC381628, PGR23
MMRRC Submission 039728-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1695 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30193431-30205722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30203555 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 75 (N75I)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117]
Predicted Effect probably benign
Transcript: ENSMUST00000088117
AA Change: N75I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: N75I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135322
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,874,644 D10E probably damaging Het
Adam1b T A 5: 121,500,907 T692S probably benign Het
Adgrg5 A G 8: 94,937,745 M328V probably damaging Het
Adk A G 14: 21,381,600 D286G probably benign Het
Ankrd28 T A 14: 31,707,244 D917V probably damaging Het
Appl2 C T 10: 83,621,582 D141N probably damaging Het
Arfgef2 T C 2: 166,864,712 V952A probably damaging Het
Arpc2 T A 1: 74,248,232 H70Q probably damaging Het
Bpifa5 T C 2: 154,167,660 L261P probably damaging Het
Brca1 G T 11: 101,524,455 T951K probably damaging Het
Ccdc189 A G 7: 127,587,573 probably null Het
Ccdc73 A T 2: 104,992,105 S800C probably damaging Het
Cdh15 C G 8: 122,862,016 D276E probably benign Het
Cfh T C 1: 140,102,837 I551V probably damaging Het
Chd7 T A 4: 8,833,960 L1238Q probably damaging Het
Chd9 T G 8: 91,001,782 F1275L probably damaging Het
Chrnb3 A G 8: 27,393,700 Y155C probably damaging Het
Cltc C A 11: 86,701,060 probably null Het
Ctsll3 T A 13: 60,800,977 N55Y probably damaging Het
Cysltr2 T C 14: 73,029,881 M130V probably benign Het
Daglb T C 5: 143,494,606 M455T probably benign Het
Dbn1 A G 13: 55,476,708 S343P probably benign Het
Dnah2 T A 11: 69,514,691 D665V possibly damaging Het
Dusp6 T A 10: 99,263,693 M1K probably null Het
Eif3m T C 2: 105,016,953 E12G probably damaging Het
Epha2 T C 4: 141,306,517 V29A possibly damaging Het
Fam160b1 T C 19: 57,379,171 W337R probably damaging Het
Farp2 T A 1: 93,560,325 N91K probably damaging Het
Ferd3l C A 12: 33,928,972 S161R probably benign Het
Fgd2 A T 17: 29,368,245 D315V possibly damaging Het
Fstl4 T A 11: 53,165,878 probably null Het
Grm5 A G 7: 88,036,103 D476G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdlbp A G 1: 93,437,200 L115P probably damaging Het
Hk2 T A 6: 82,744,951 N136Y probably damaging Het
Hs2st1 G T 3: 144,434,654 A302E probably benign Het
Htr7 T C 19: 35,969,736 N293D probably benign Het
Ikbkb T A 8: 22,673,480 E271D probably benign Het
Il5ra A T 6: 106,738,374 Y166* probably null Het
Il9r T A 11: 32,193,227 H244L probably benign Het
Itih4 T C 14: 30,891,499 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Limk2 A G 11: 3,353,275 probably null Het
Med15 A G 16: 17,722,780 F34S probably damaging Het
Mprip C T 11: 59,752,531 T505I probably damaging Het
Mtor T A 4: 148,538,907 N2071K probably benign Het
Muc16 A G 9: 18,497,433 L2522P probably damaging Het
Myd88 A T 9: 119,337,842 probably null Het
Myo7a A C 7: 98,092,496 F484V possibly damaging Het
Nme1 A C 11: 93,960,767 L81R probably benign Het
Ntn4 T A 10: 93,733,602 probably null Het
Olfr1180 T C 2: 88,412,100 D186G probably damaging Het
Olfr1383 T C 11: 49,524,335 V204A probably benign Het
Olfr630 A T 7: 103,754,924 Y220* probably null Het
Otogl T G 10: 107,814,017 N1159T probably damaging Het
Pabpc6 G A 17: 9,668,074 T516I probably benign Het
Pcdh1 C T 18: 38,202,868 R238H probably damaging Het
Pex5l T A 3: 32,954,382 N151I probably benign Het
Plekha7 T C 7: 116,128,685 N980S probably damaging Het
Reg4 C T 3: 98,236,361 T157I probably benign Het
Rev3l G T 10: 39,824,615 E1703* probably null Het
Rev3l A T 10: 39,824,616 E1703V probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Saal1 T C 7: 46,692,916 K368E probably damaging Het
Scn9a C T 2: 66,504,876 W1245* probably null Het
Slc38a11 T A 2: 65,316,971 L387F probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sptb C A 12: 76,620,867 V819L probably benign Het
Sptbn1 T C 11: 30,136,124 T1195A probably benign Het
Ssna1 C A 2: 25,272,012 V57F possibly damaging Het
Stk32a G T 18: 43,313,420 E312* probably null Het
Synpo A G 18: 60,603,387 F496L probably benign Het
Syt15 C T 14: 34,222,901 T135M probably benign Het
Tm9sf4 A G 2: 153,190,912 E246G probably benign Het
Trim44 T C 2: 102,357,485 M308V possibly damaging Het
Unc119b T A 5: 115,134,826 K29* probably null Het
Vim T A 2: 13,580,110 D367E probably benign Het
Virma T A 4: 11,494,814 N38K probably damaging Het
Vmn1r228 A T 17: 20,776,298 D319E possibly damaging Het
Vmn2r32 T A 7: 7,463,992 I846F probably benign Het
Vps13b T C 15: 35,576,521 V1025A probably benign Het
Vps13c G T 9: 67,972,075 E566* probably null Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACACCCTCGTGAAGTTCCTCACTAC -3'
(R):5'- GAGATGACATCTGCTTGTGTCCCC -3'

Sequencing Primer
(F):5'- CTATCAGAACATTGGGACATGAAC -3'
(R):5'- GCTTGTGTCCCCGGAAATG -3'
Posted On2014-05-14