Mutagenetix > Incidental Mutations

Incidental Mutation 'R1695:Large1'

192132

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

039728-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.588) question?

Stock #

R1695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72818082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 689 (D689E)

Ref Sequence

ENSEMBL: ENSMUSP00000148336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: D689E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: D689E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: D689E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: D689E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: D689E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.2491

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,874,644	D10E	probably damaging	Het
Adam1b	T	A	5: 121,500,907	T692S	probably benign	Het
Adgrf3	T	A	5: 30,203,555	N75I	probably benign	Het
Adgrg5	A	G	8: 94,937,745	M328V	probably damaging	Het
Adk	A	G	14: 21,381,600	D286G	probably benign	Het
Ankrd28	T	A	14: 31,707,244	D917V	probably damaging	Het
Appl2	C	T	10: 83,621,582	D141N	probably damaging	Het
Arfgef2	T	C	2: 166,864,712	V952A	probably damaging	Het
Arpc2	T	A	1: 74,248,232	H70Q	probably damaging	Het
Bpifa5	T	C	2: 154,167,660	L261P	probably damaging	Het
Brca1	G	T	11: 101,524,455	T951K	probably damaging	Het
Ccdc189	A	G	7: 127,587,573		probably null	Het
Ccdc73	A	T	2: 104,992,105	S800C	probably damaging	Het
Cdh15	C	G	8: 122,862,016	D276E	probably benign	Het
Cfh	T	C	1: 140,102,837	I551V	probably damaging	Het
Chd7	T	A	4: 8,833,960	L1238Q	probably damaging	Het
Chd9	T	G	8: 91,001,782	F1275L	probably damaging	Het
Chrnb3	A	G	8: 27,393,700	Y155C	probably damaging	Het
Cltc	C	A	11: 86,701,060		probably null	Het
Ctsll3	T	A	13: 60,800,977	N55Y	probably damaging	Het
Cysltr2	T	C	14: 73,029,881	M130V	probably benign	Het
Daglb	T	C	5: 143,494,606	M455T	probably benign	Het
Dbn1	A	G	13: 55,476,708	S343P	probably benign	Het
Dnah2	T	A	11: 69,514,691	D665V	possibly damaging	Het
Dusp6	T	A	10: 99,263,693	M1K	probably null	Het
Eif3m	T	C	2: 105,016,953	E12G	probably damaging	Het
Epha2	T	C	4: 141,306,517	V29A	possibly damaging	Het
Fam160b1	T	C	19: 57,379,171	W337R	probably damaging	Het
Farp2	T	A	1: 93,560,325	N91K	probably damaging	Het
Ferd3l	C	A	12: 33,928,972	S161R	probably benign	Het
Fgd2	A	T	17: 29,368,245	D315V	possibly damaging	Het
Fstl4	T	A	11: 53,165,878		probably null	Het
Grm5	A	G	7: 88,036,103	D476G	possibly damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdlbp	A	G	1: 93,437,200	L115P	probably damaging	Het
Hk2	T	A	6: 82,744,951	N136Y	probably damaging	Het
Hs2st1	G	T	3: 144,434,654	A302E	probably benign	Het
Htr7	T	C	19: 35,969,736	N293D	probably benign	Het
Ikbkb	T	A	8: 22,673,480	E271D	probably benign	Het
Il5ra	A	T	6: 106,738,374	Y166*	probably null	Het
Il9r	T	A	11: 32,193,227	H244L	probably benign	Het
Itih4	T	C	14: 30,891,499		probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Limk2	A	G	11: 3,353,275		probably null	Het
Med15	A	G	16: 17,722,780	F34S	probably damaging	Het
Mprip	C	T	11: 59,752,531	T505I	probably damaging	Het
Mtor	T	A	4: 148,538,907	N2071K	probably benign	Het
Muc16	A	G	9: 18,497,433	L2522P	probably damaging	Het
Myd88	A	T	9: 119,337,842		probably null	Het
Myo7a	A	C	7: 98,092,496	F484V	possibly damaging	Het
Nme1	A	C	11: 93,960,767	L81R	probably benign	Het
Ntn4	T	A	10: 93,733,602		probably null	Het
Olfr1180	T	C	2: 88,412,100	D186G	probably damaging	Het
Olfr1383	T	C	11: 49,524,335	V204A	probably benign	Het
Olfr630	A	T	7: 103,754,924	Y220*	probably null	Het
Otogl	T	G	10: 107,814,017	N1159T	probably damaging	Het
Pabpc6	G	A	17: 9,668,074	T516I	probably benign	Het
Pcdh1	C	T	18: 38,202,868	R238H	probably damaging	Het
Pex5l	T	A	3: 32,954,382	N151I	probably benign	Het
Plekha7	T	C	7: 116,128,685	N980S	probably damaging	Het
Reg4	C	T	3: 98,236,361	T157I	probably benign	Het
Rev3l	G	T	10: 39,824,615	E1703*	probably null	Het
Rev3l	A	T	10: 39,824,616	E1703V	probably damaging	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Saal1	T	C	7: 46,692,916	K368E	probably damaging	Het
Scn9a	C	T	2: 66,504,876	W1245*	probably null	Het
Slc38a11	T	A	2: 65,316,971	L387F	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sptb	C	A	12: 76,620,867	V819L	probably benign	Het
Sptbn1	T	C	11: 30,136,124	T1195A	probably benign	Het
Ssna1	C	A	2: 25,272,012	V57F	possibly damaging	Het
Stk32a	G	T	18: 43,313,420	E312*	probably null	Het
Synpo	A	G	18: 60,603,387	F496L	probably benign	Het
Syt15	C	T	14: 34,222,901	T135M	probably benign	Het
Tm9sf4	A	G	2: 153,190,912	E246G	probably benign	Het
Trim44	T	C	2: 102,357,485	M308V	possibly damaging	Het
Unc119b	T	A	5: 115,134,826	K29*	probably null	Het
Vim	T	A	2: 13,580,110	D367E	probably benign	Het
Virma	T	A	4: 11,494,814	N38K	probably damaging	Het
Vmn1r228	A	T	17: 20,776,298	D319E	possibly damaging	Het
Vmn2r32	T	A	7: 7,463,992	I846F	probably benign	Het
Vps13b	T	C	15: 35,576,521	V1025A	probably benign	Het
Vps13c	G	T	9: 67,972,075	E566*	probably null	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGCCACTTACAGTGAGGCAATC -3'
(R):5'- GTATGGACTAAAGGCCATGCACCC -3'

Sequencing Primer
(F):5'- GTGTCCAGTCATAAGCAGTAATCC -3'
(R):5'- CCCACAAACTTTGCCAAGTG -3'

Posted On

2014-05-14