Incidental Mutation 'R1695:Muc16'
ID192136
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission 039728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1695 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18497433 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2522 (L2522P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]
Predicted Effect probably benign
Transcript: ENSMUST00000034653
AA Change: L215P

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564
AA Change: L215P

DomainStartEndE-ValueType
Pfam:SEA 71 174 9.6e-30 PFAM
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207857
AA Change: L2522P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: L8435P

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,874,644 D10E probably damaging Het
Adam1b T A 5: 121,500,907 T692S probably benign Het
Adgrf3 T A 5: 30,203,555 N75I probably benign Het
Adgrg5 A G 8: 94,937,745 M328V probably damaging Het
Adk A G 14: 21,381,600 D286G probably benign Het
Ankrd28 T A 14: 31,707,244 D917V probably damaging Het
Appl2 C T 10: 83,621,582 D141N probably damaging Het
Arfgef2 T C 2: 166,864,712 V952A probably damaging Het
Arpc2 T A 1: 74,248,232 H70Q probably damaging Het
Bpifa5 T C 2: 154,167,660 L261P probably damaging Het
Brca1 G T 11: 101,524,455 T951K probably damaging Het
Ccdc189 A G 7: 127,587,573 probably null Het
Ccdc73 A T 2: 104,992,105 S800C probably damaging Het
Cdh15 C G 8: 122,862,016 D276E probably benign Het
Cfh T C 1: 140,102,837 I551V probably damaging Het
Chd7 T A 4: 8,833,960 L1238Q probably damaging Het
Chd9 T G 8: 91,001,782 F1275L probably damaging Het
Chrnb3 A G 8: 27,393,700 Y155C probably damaging Het
Cltc C A 11: 86,701,060 probably null Het
Ctsll3 T A 13: 60,800,977 N55Y probably damaging Het
Cysltr2 T C 14: 73,029,881 M130V probably benign Het
Daglb T C 5: 143,494,606 M455T probably benign Het
Dbn1 A G 13: 55,476,708 S343P probably benign Het
Dnah2 T A 11: 69,514,691 D665V possibly damaging Het
Dusp6 T A 10: 99,263,693 M1K probably null Het
Eif3m T C 2: 105,016,953 E12G probably damaging Het
Epha2 T C 4: 141,306,517 V29A possibly damaging Het
Fam160b1 T C 19: 57,379,171 W337R probably damaging Het
Farp2 T A 1: 93,560,325 N91K probably damaging Het
Ferd3l C A 12: 33,928,972 S161R probably benign Het
Fgd2 A T 17: 29,368,245 D315V possibly damaging Het
Fstl4 T A 11: 53,165,878 probably null Het
Grm5 A G 7: 88,036,103 D476G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdlbp A G 1: 93,437,200 L115P probably damaging Het
Hk2 T A 6: 82,744,951 N136Y probably damaging Het
Hs2st1 G T 3: 144,434,654 A302E probably benign Het
Htr7 T C 19: 35,969,736 N293D probably benign Het
Ikbkb T A 8: 22,673,480 E271D probably benign Het
Il5ra A T 6: 106,738,374 Y166* probably null Het
Il9r T A 11: 32,193,227 H244L probably benign Het
Itih4 T C 14: 30,891,499 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Limk2 A G 11: 3,353,275 probably null Het
Med15 A G 16: 17,722,780 F34S probably damaging Het
Mprip C T 11: 59,752,531 T505I probably damaging Het
Mtor T A 4: 148,538,907 N2071K probably benign Het
Myd88 A T 9: 119,337,842 probably null Het
Myo7a A C 7: 98,092,496 F484V possibly damaging Het
Nme1 A C 11: 93,960,767 L81R probably benign Het
Ntn4 T A 10: 93,733,602 probably null Het
Olfr1180 T C 2: 88,412,100 D186G probably damaging Het
Olfr1383 T C 11: 49,524,335 V204A probably benign Het
Olfr630 A T 7: 103,754,924 Y220* probably null Het
Otogl T G 10: 107,814,017 N1159T probably damaging Het
Pabpc6 G A 17: 9,668,074 T516I probably benign Het
Pcdh1 C T 18: 38,202,868 R238H probably damaging Het
Pex5l T A 3: 32,954,382 N151I probably benign Het
Plekha7 T C 7: 116,128,685 N980S probably damaging Het
Reg4 C T 3: 98,236,361 T157I probably benign Het
Rev3l G T 10: 39,824,615 E1703* probably null Het
Rev3l A T 10: 39,824,616 E1703V probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Saal1 T C 7: 46,692,916 K368E probably damaging Het
Scn9a C T 2: 66,504,876 W1245* probably null Het
Slc38a11 T A 2: 65,316,971 L387F probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sptb C A 12: 76,620,867 V819L probably benign Het
Sptbn1 T C 11: 30,136,124 T1195A probably benign Het
Ssna1 C A 2: 25,272,012 V57F possibly damaging Het
Stk32a G T 18: 43,313,420 E312* probably null Het
Synpo A G 18: 60,603,387 F496L probably benign Het
Syt15 C T 14: 34,222,901 T135M probably benign Het
Tm9sf4 A G 2: 153,190,912 E246G probably benign Het
Trim44 T C 2: 102,357,485 M308V possibly damaging Het
Unc119b T A 5: 115,134,826 K29* probably null Het
Vim T A 2: 13,580,110 D367E probably benign Het
Virma T A 4: 11,494,814 N38K probably damaging Het
Vmn1r228 A T 17: 20,776,298 D319E possibly damaging Het
Vmn2r32 T A 7: 7,463,992 I846F probably benign Het
Vps13b T C 15: 35,576,521 V1025A probably benign Het
Vps13c G T 9: 67,972,075 E566* probably null Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- tgggATGGTTGTGTCTTATGGCAAG -3'
(R):5'- GAATGACCCATGCCCGAGTATCAC -3'

Sequencing Primer
(F):5'- acttcatatcttcatcagcacttac -3'
(R):5'- GTCCTGCTTGAGACCCATACAG -3'
Posted On2014-05-14