Mutagenetix > Incidental Mutation

Incidental Mutation 'R1695:Muc16'

192136

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

039728-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R1695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18497433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 2522 (L2522P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034653
AA Change: L215P

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564
AA Change: L215P

Domain	Start	End	E-Value	Type
Pfam:SEA	71	174	9.6e-30	PFAM
transmembrane domain	205	227	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207857
AA Change: L2522P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000208663
AA Change: L8435P

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,874,644	D10E	probably damaging	Het
Adam1b	T	A	5: 121,500,907	T692S	probably benign	Het
Adgrf3	T	A	5: 30,203,555	N75I	probably benign	Het
Adgrg5	A	G	8: 94,937,745	M328V	probably damaging	Het
Adk	A	G	14: 21,381,600	D286G	probably benign	Het
Ankrd28	T	A	14: 31,707,244	D917V	probably damaging	Het
Appl2	C	T	10: 83,621,582	D141N	probably damaging	Het
Arfgef2	T	C	2: 166,864,712	V952A	probably damaging	Het
Arpc2	T	A	1: 74,248,232	H70Q	probably damaging	Het
Bpifa5	T	C	2: 154,167,660	L261P	probably damaging	Het
Brca1	G	T	11: 101,524,455	T951K	probably damaging	Het
Ccdc189	A	G	7: 127,587,573		probably null	Het
Ccdc73	A	T	2: 104,992,105	S800C	probably damaging	Het
Cdh15	C	G	8: 122,862,016	D276E	probably benign	Het
Cfh	T	C	1: 140,102,837	I551V	probably damaging	Het
Chd7	T	A	4: 8,833,960	L1238Q	probably damaging	Het
Chd9	T	G	8: 91,001,782	F1275L	probably damaging	Het
Chrnb3	A	G	8: 27,393,700	Y155C	probably damaging	Het
Cltc	C	A	11: 86,701,060		probably null	Het
Ctsll3	T	A	13: 60,800,977	N55Y	probably damaging	Het
Cysltr2	T	C	14: 73,029,881	M130V	probably benign	Het
Daglb	T	C	5: 143,494,606	M455T	probably benign	Het
Dbn1	A	G	13: 55,476,708	S343P	probably benign	Het
Dnah2	T	A	11: 69,514,691	D665V	possibly damaging	Het
Dusp6	T	A	10: 99,263,693	M1K	probably null	Het
Eif3m	T	C	2: 105,016,953	E12G	probably damaging	Het
Epha2	T	C	4: 141,306,517	V29A	possibly damaging	Het
Fam160b1	T	C	19: 57,379,171	W337R	probably damaging	Het
Farp2	T	A	1: 93,560,325	N91K	probably damaging	Het
Ferd3l	C	A	12: 33,928,972	S161R	probably benign	Het
Fgd2	A	T	17: 29,368,245	D315V	possibly damaging	Het
Fstl4	T	A	11: 53,165,878		probably null	Het
Grm5	A	G	7: 88,036,103	D476G	possibly damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdlbp	A	G	1: 93,437,200	L115P	probably damaging	Het
Hk2	T	A	6: 82,744,951	N136Y	probably damaging	Het
Hs2st1	G	T	3: 144,434,654	A302E	probably benign	Het
Htr7	T	C	19: 35,969,736	N293D	probably benign	Het
Ikbkb	T	A	8: 22,673,480	E271D	probably benign	Het
Il5ra	A	T	6: 106,738,374	Y166*	probably null	Het
Il9r	T	A	11: 32,193,227	H244L	probably benign	Het
Itih4	T	C	14: 30,891,499		probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Large1	A	T	8: 72,818,082	D689E	probably damaging	Het
Limk2	A	G	11: 3,353,275		probably null	Het
Med15	A	G	16: 17,722,780	F34S	probably damaging	Het
Mprip	C	T	11: 59,752,531	T505I	probably damaging	Het
Mtor	T	A	4: 148,538,907	N2071K	probably benign	Het
Myd88	A	T	9: 119,337,842		probably null	Het
Myo7a	A	C	7: 98,092,496	F484V	possibly damaging	Het
Nme1	A	C	11: 93,960,767	L81R	probably benign	Het
Ntn4	T	A	10: 93,733,602		probably null	Het
Olfr1180	T	C	2: 88,412,100	D186G	probably damaging	Het
Olfr1383	T	C	11: 49,524,335	V204A	probably benign	Het
Olfr630	A	T	7: 103,754,924	Y220*	probably null	Het
Otogl	T	G	10: 107,814,017	N1159T	probably damaging	Het
Pabpc6	G	A	17: 9,668,074	T516I	probably benign	Het
Pcdh1	C	T	18: 38,202,868	R238H	probably damaging	Het
Pex5l	T	A	3: 32,954,382	N151I	probably benign	Het
Plekha7	T	C	7: 116,128,685	N980S	probably damaging	Het
Reg4	C	T	3: 98,236,361	T157I	probably benign	Het
Rev3l	A	T	10: 39,824,616	E1703V	probably damaging	Het
Rev3l	G	T	10: 39,824,615	E1703*	probably null	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Saal1	T	C	7: 46,692,916	K368E	probably damaging	Het
Scn9a	C	T	2: 66,504,876	W1245*	probably null	Het
Slc38a11	T	A	2: 65,316,971	L387F	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sptb	C	A	12: 76,620,867	V819L	probably benign	Het
Sptbn1	T	C	11: 30,136,124	T1195A	probably benign	Het
Ssna1	C	A	2: 25,272,012	V57F	possibly damaging	Het
Stk32a	G	T	18: 43,313,420	E312*	probably null	Het
Synpo	A	G	18: 60,603,387	F496L	probably benign	Het
Syt15	C	T	14: 34,222,901	T135M	probably benign	Het
Tm9sf4	A	G	2: 153,190,912	E246G	probably benign	Het
Trim44	T	C	2: 102,357,485	M308V	possibly damaging	Het
Unc119b	T	A	5: 115,134,826	K29*	probably null	Het
Vim	T	A	2: 13,580,110	D367E	probably benign	Het
Virma	T	A	4: 11,494,814	N38K	probably damaging	Het
Vmn1r228	A	T	17: 20,776,298	D319E	possibly damaging	Het
Vmn2r32	T	A	7: 7,463,992	I846F	probably benign	Het
Vps13b	T	C	15: 35,576,521	V1025A	probably benign	Het
Vps13c	G	T	9: 67,972,075	E566*	probably null	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
Brimming	UTSW	9	18592680	missense	probably damaging	0.99
R7038_muc16_859	UTSW	9	18620468	missense	probably damaging	0.99
Runneymeade	UTSW	9	18579317	critical splice donor site	probably null
slimey	UTSW	9	18590698	missense	probably damaging	1.00
viscous	UTSW	9	18644732	missense	unknown
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
R8679:Muc16	UTSW	9	18646448	missense	unknown
R8680:Muc16	UTSW	9	18644719	missense	unknown
R8720:Muc16	UTSW	9	18641600	missense	probably benign	0.01
R8729:Muc16	UTSW	9	18660050	missense	unknown
R8736:Muc16	UTSW	9	18550843	nonsense	probably null
R8739:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R8807:Muc16	UTSW	9	18656057	missense	unknown
R8830:Muc16	UTSW	9	18646069	missense	unknown
R8871:Muc16	UTSW	9	18656048	missense	unknown
R8884:Muc16	UTSW	9	18644200	missense	unknown
R8923:Muc16	UTSW	9	18638676	missense	probably benign	0.01
R8948:Muc16	UTSW	9	18647233	missense	unknown
R8949:Muc16	UTSW	9	18520925	critical splice donor site	probably null
R8987:Muc16	UTSW	9	18551685	nonsense	probably null
R8997:Muc16	UTSW	9	18607467	intron	probably benign
R9013:Muc16	UTSW	9	18512773	missense	possibly damaging	0.94
R9020:Muc16	UTSW	9	18638719	small insertion	probably benign
R9036:Muc16	UTSW	9	18644679	missense	unknown
R9040:Muc16	UTSW	9	18644786	nonsense	probably null
R9065:Muc16	UTSW	9	18643009	missense	unknown
R9089:Muc16	UTSW	9	18644550	missense	unknown
R9098:Muc16	UTSW	9	18643679	missense	unknown
R9100:Muc16	UTSW	9	18645670	missense	unknown
R9128:Muc16	UTSW	9	18647582	missense	unknown
R9169:Muc16	UTSW	9	18656528	missense	unknown
R9180:Muc16	UTSW	9	18642742	missense	unknown
R9191:Muc16	UTSW	9	18644810	missense	unknown
R9203:Muc16	UTSW	9	18551688	missense	unknown
R9208:Muc16	UTSW	9	18508537	missense	probably damaging	0.99
R9232:Muc16	UTSW	9	18656040	missense	unknown
R9240:Muc16	UTSW	9	18538013	missense	unknown
R9254:Muc16	UTSW	9	18646171	missense	unknown
R9330:Muc16	UTSW	9	18641036	missense	probably benign	0.04
R9347:Muc16	UTSW	9	18660215	missense	unknown
R9358:Muc16	UTSW	9	18642224	missense	probably benign	0.01
R9359:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9379:Muc16	UTSW	9	18646171	missense	unknown
R9403:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9422:Muc16	UTSW	9	18641806	missense	probably benign	0.01
R9433:Muc16	UTSW	9	18572641	missense	probably benign	0.09
R9438:Muc16	UTSW	9	18647732	missense	unknown
R9442:Muc16	UTSW	9	18655328	missense	unknown
R9453:Muc16	UTSW	9	18660765	missense	unknown
R9467:Muc16	UTSW	9	18597035	missense	probably benign	0.03
R9490:Muc16	UTSW	9	18656853	nonsense	probably null
R9519:Muc16	UTSW	9	18586920	missense	probably benign	0.03
R9524:Muc16	UTSW	9	18586018	missense	probably benign	0.03
R9556:Muc16	UTSW	9	18658638	missense	unknown
R9583:Muc16	UTSW	9	18638677	missense	probably benign	0.01
R9600:Muc16	UTSW	9	18655851	missense	unknown
R9638:Muc16	UTSW	9	18639330	missense	probably benign	0.12
R9650:Muc16	UTSW	9	18642466	missense	unknown
R9652:Muc16	UTSW	9	18586882	missense	probably benign	0.03
R9666:Muc16	UTSW	9	18655989	missense	unknown
R9682:Muc16	UTSW	9	18642578	missense	unknown
R9765:Muc16	UTSW	9	18637198	missense	probably benign	0.16
R9766:Muc16	UTSW	9	18636857	missense	probably benign	0.08
R9766:Muc16	UTSW	9	18641087	missense	probably benign	0.01
R9776:Muc16	UTSW	9	18659379	missense	unknown
R9782:Muc16	UTSW	9	18636770	missense	possibly damaging	0.64
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- tgggATGGTTGTGTCTTATGGCAAG -3'
(R):5'- GAATGACCCATGCCCGAGTATCAC -3'

Sequencing Primer
(F):5'- acttcatatcttcatcagcacttac -3'
(R):5'- GTCCTGCTTGAGACCCATACAG -3'

Posted On

2014-05-14