Incidental Mutation 'R1695:Nme1'
ID192154
Institutional Source Beutler Lab
Gene Symbol Nme1
Ensembl Gene ENSMUSG00000037601
Gene NameNME/NM23 nucleoside diphosphate kinase 1
SynonymsNDPK-A, non-metastatic cells 1, protein (NM23A) expressed in, NM23-M1
MMRRC Submission 039728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1695 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location93956979-93968521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93960767 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 81 (L81R)
Ref Sequence ENSEMBL: ENSMUSP00000117022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021217] [ENSMUST00000021220] [ENSMUST00000072566] [ENSMUST00000107844] [ENSMUST00000135884] [ENSMUST00000170303]
Predicted Effect probably benign
Transcript: ENSMUST00000021217
SMART Domains Protein: ENSMUSP00000021217
Gene: ENSMUSG00000020857

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021220
AA Change: L81R

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021220
Gene: ENSMUSG00000037601
AA Change: L81R

DomainStartEndE-ValueType
NDK 4 127 8.86e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072566
SMART Domains Protein: ENSMUSP00000103476
Gene: ENSMUSG00000020857

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect silent
Transcript: ENSMUST00000107844
SMART Domains Protein: ENSMUSP00000103475
Gene: ENSMUSG00000037601

DomainStartEndE-ValueType
NDK 4 102 4.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135884
AA Change: L81R

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117022
Gene: ENSMUSG00000037601
AA Change: L81R

DomainStartEndE-ValueType
NDK 4 141 5.74e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170303
AA Change: L81R

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132590
Gene: ENSMUSG00000091228
AA Change: L81R

DomainStartEndE-ValueType
NDK 4 118 7.56e-55 SMART
NDK 119 256 2.8e-90 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (NME1) was identified because of its reduced mRNA transcript levels in highly metastatic cells. Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by this gene) and 'B' (encoded by NME2) isoforms. Mutations in this gene have been identified in aggressive neuroblastomas. Two transcript variants encoding different isoforms have been found for this gene. Co-transcription of this gene and the neighboring downstream gene (NME2) generates naturally-occurring transcripts (NME1-NME2), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted mutation of this gene are born normally, but exhibited high perinatal mortality of all genotypes on congenic backgrounds. This appears to be a maternal effect because the presence of a single functioning allele in females can prevent this mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,874,644 D10E probably damaging Het
Adam1b T A 5: 121,500,907 T692S probably benign Het
Adgrf3 T A 5: 30,203,555 N75I probably benign Het
Adgrg5 A G 8: 94,937,745 M328V probably damaging Het
Adk A G 14: 21,381,600 D286G probably benign Het
Ankrd28 T A 14: 31,707,244 D917V probably damaging Het
Appl2 C T 10: 83,621,582 D141N probably damaging Het
Arfgef2 T C 2: 166,864,712 V952A probably damaging Het
Arpc2 T A 1: 74,248,232 H70Q probably damaging Het
Bpifa5 T C 2: 154,167,660 L261P probably damaging Het
Brca1 G T 11: 101,524,455 T951K probably damaging Het
Ccdc189 A G 7: 127,587,573 probably null Het
Ccdc73 A T 2: 104,992,105 S800C probably damaging Het
Cdh15 C G 8: 122,862,016 D276E probably benign Het
Cfh T C 1: 140,102,837 I551V probably damaging Het
Chd7 T A 4: 8,833,960 L1238Q probably damaging Het
Chd9 T G 8: 91,001,782 F1275L probably damaging Het
Chrnb3 A G 8: 27,393,700 Y155C probably damaging Het
Cltc C A 11: 86,701,060 probably null Het
Ctsll3 T A 13: 60,800,977 N55Y probably damaging Het
Cysltr2 T C 14: 73,029,881 M130V probably benign Het
Daglb T C 5: 143,494,606 M455T probably benign Het
Dbn1 A G 13: 55,476,708 S343P probably benign Het
Dnah2 T A 11: 69,514,691 D665V possibly damaging Het
Dusp6 T A 10: 99,263,693 M1K probably null Het
Eif3m T C 2: 105,016,953 E12G probably damaging Het
Epha2 T C 4: 141,306,517 V29A possibly damaging Het
Fam160b1 T C 19: 57,379,171 W337R probably damaging Het
Farp2 T A 1: 93,560,325 N91K probably damaging Het
Ferd3l C A 12: 33,928,972 S161R probably benign Het
Fgd2 A T 17: 29,368,245 D315V possibly damaging Het
Fstl4 T A 11: 53,165,878 probably null Het
Grm5 A G 7: 88,036,103 D476G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdlbp A G 1: 93,437,200 L115P probably damaging Het
Hk2 T A 6: 82,744,951 N136Y probably damaging Het
Hs2st1 G T 3: 144,434,654 A302E probably benign Het
Htr7 T C 19: 35,969,736 N293D probably benign Het
Ikbkb T A 8: 22,673,480 E271D probably benign Het
Il5ra A T 6: 106,738,374 Y166* probably null Het
Il9r T A 11: 32,193,227 H244L probably benign Het
Itih4 T C 14: 30,891,499 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Limk2 A G 11: 3,353,275 probably null Het
Med15 A G 16: 17,722,780 F34S probably damaging Het
Mprip C T 11: 59,752,531 T505I probably damaging Het
Mtor T A 4: 148,538,907 N2071K probably benign Het
Muc16 A G 9: 18,497,433 L2522P probably damaging Het
Myd88 A T 9: 119,337,842 probably null Het
Myo7a A C 7: 98,092,496 F484V possibly damaging Het
Ntn4 T A 10: 93,733,602 probably null Het
Olfr1180 T C 2: 88,412,100 D186G probably damaging Het
Olfr1383 T C 11: 49,524,335 V204A probably benign Het
Olfr630 A T 7: 103,754,924 Y220* probably null Het
Otogl T G 10: 107,814,017 N1159T probably damaging Het
Pabpc6 G A 17: 9,668,074 T516I probably benign Het
Pcdh1 C T 18: 38,202,868 R238H probably damaging Het
Pex5l T A 3: 32,954,382 N151I probably benign Het
Plekha7 T C 7: 116,128,685 N980S probably damaging Het
Reg4 C T 3: 98,236,361 T157I probably benign Het
Rev3l G T 10: 39,824,615 E1703* probably null Het
Rev3l A T 10: 39,824,616 E1703V probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Saal1 T C 7: 46,692,916 K368E probably damaging Het
Scn9a C T 2: 66,504,876 W1245* probably null Het
Slc38a11 T A 2: 65,316,971 L387F probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sptb C A 12: 76,620,867 V819L probably benign Het
Sptbn1 T C 11: 30,136,124 T1195A probably benign Het
Ssna1 C A 2: 25,272,012 V57F possibly damaging Het
Stk32a G T 18: 43,313,420 E312* probably null Het
Synpo A G 18: 60,603,387 F496L probably benign Het
Syt15 C T 14: 34,222,901 T135M probably benign Het
Tm9sf4 A G 2: 153,190,912 E246G probably benign Het
Trim44 T C 2: 102,357,485 M308V possibly damaging Het
Unc119b T A 5: 115,134,826 K29* probably null Het
Vim T A 2: 13,580,110 D367E probably benign Het
Virma T A 4: 11,494,814 N38K probably damaging Het
Vmn1r228 A T 17: 20,776,298 D319E possibly damaging Het
Vmn2r32 T A 7: 7,463,992 I846F probably benign Het
Vps13b T C 15: 35,576,521 V1025A probably benign Het
Vps13c G T 9: 67,972,075 E566* probably null Het
Other mutations in Nme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Nme1 APN 11 93959491 missense possibly damaging 0.58
IGL02533:Nme1 APN 11 93959431 missense possibly damaging 0.89
R2512:Nme1 UTSW 11 93960687 missense possibly damaging 0.73
R4182:Nme1 UTSW 11 93960804 missense probably benign 0.00
R4701:Nme1 UTSW 11 93965908 missense probably damaging 1.00
R6928:Nme1 UTSW 11 93959403 missense probably damaging 0.96
R8794:Nme1 UTSW 11 93960832 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGTGTTCATTTCTAGACTCAGAGGCTC -3'
(R):5'- AAGATTGCTGGAAGCCACACGG -3'

Sequencing Primer
(F):5'- GCTCAAATTCCTGTGGCAAG -3'
(R):5'- CACACGGATGGGTCTGAATTG -3'
Posted On2014-05-14