Mutagenetix > Incidental Mutation

Incidental Mutation 'R1695:Brca1'

192155

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

039728-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 101524455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 951 (T951K)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

AlphaFold

P48754

Predicted Effect

probably damaging
Transcript: ENSMUST00000017290
AA Change: T951K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: T951K

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,874,644	D10E	probably damaging	Het
Adam1b	T	A	5: 121,500,907	T692S	probably benign	Het
Adgrf3	T	A	5: 30,203,555	N75I	probably benign	Het
Adgrg5	A	G	8: 94,937,745	M328V	probably damaging	Het
Adk	A	G	14: 21,381,600	D286G	probably benign	Het
Ankrd28	T	A	14: 31,707,244	D917V	probably damaging	Het
Appl2	C	T	10: 83,621,582	D141N	probably damaging	Het
Arfgef2	T	C	2: 166,864,712	V952A	probably damaging	Het
Arpc2	T	A	1: 74,248,232	H70Q	probably damaging	Het
Bpifa5	T	C	2: 154,167,660	L261P	probably damaging	Het
Ccdc189	A	G	7: 127,587,573		probably null	Het
Ccdc73	A	T	2: 104,992,105	S800C	probably damaging	Het
Cdh15	C	G	8: 122,862,016	D276E	probably benign	Het
Cfh	T	C	1: 140,102,837	I551V	probably damaging	Het
Chd7	T	A	4: 8,833,960	L1238Q	probably damaging	Het
Chd9	T	G	8: 91,001,782	F1275L	probably damaging	Het
Chrnb3	A	G	8: 27,393,700	Y155C	probably damaging	Het
Cltc	C	A	11: 86,701,060		probably null	Het
Ctsll3	T	A	13: 60,800,977	N55Y	probably damaging	Het
Cysltr2	T	C	14: 73,029,881	M130V	probably benign	Het
Daglb	T	C	5: 143,494,606	M455T	probably benign	Het
Dbn1	A	G	13: 55,476,708	S343P	probably benign	Het
Dnah2	T	A	11: 69,514,691	D665V	possibly damaging	Het
Dusp6	T	A	10: 99,263,693	M1K	probably null	Het
Eif3m	T	C	2: 105,016,953	E12G	probably damaging	Het
Epha2	T	C	4: 141,306,517	V29A	possibly damaging	Het
Fam160b1	T	C	19: 57,379,171	W337R	probably damaging	Het
Farp2	T	A	1: 93,560,325	N91K	probably damaging	Het
Ferd3l	C	A	12: 33,928,972	S161R	probably benign	Het
Fgd2	A	T	17: 29,368,245	D315V	possibly damaging	Het
Fstl4	T	A	11: 53,165,878		probably null	Het
Grm5	A	G	7: 88,036,103	D476G	possibly damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdlbp	A	G	1: 93,437,200	L115P	probably damaging	Het
Hk2	T	A	6: 82,744,951	N136Y	probably damaging	Het
Hs2st1	G	T	3: 144,434,654	A302E	probably benign	Het
Htr7	T	C	19: 35,969,736	N293D	probably benign	Het
Ikbkb	T	A	8: 22,673,480	E271D	probably benign	Het
Il5ra	A	T	6: 106,738,374	Y166*	probably null	Het
Il9r	T	A	11: 32,193,227	H244L	probably benign	Het
Itih4	T	C	14: 30,891,499		probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Large1	A	T	8: 72,818,082	D689E	probably damaging	Het
Limk2	A	G	11: 3,353,275		probably null	Het
Med15	A	G	16: 17,722,780	F34S	probably damaging	Het
Mprip	C	T	11: 59,752,531	T505I	probably damaging	Het
Mtor	T	A	4: 148,538,907	N2071K	probably benign	Het
Muc16	A	G	9: 18,497,433	L2522P	probably damaging	Het
Myd88	A	T	9: 119,337,842		probably null	Het
Myo7a	A	C	7: 98,092,496	F484V	possibly damaging	Het
Nme1	A	C	11: 93,960,767	L81R	probably benign	Het
Ntn4	T	A	10: 93,733,602		probably null	Het
Olfr1180	T	C	2: 88,412,100	D186G	probably damaging	Het
Olfr1383	T	C	11: 49,524,335	V204A	probably benign	Het
Olfr630	A	T	7: 103,754,924	Y220*	probably null	Het
Otogl	T	G	10: 107,814,017	N1159T	probably damaging	Het
Pabpc6	G	A	17: 9,668,074	T516I	probably benign	Het
Pcdh1	C	T	18: 38,202,868	R238H	probably damaging	Het
Pex5l	T	A	3: 32,954,382	N151I	probably benign	Het
Plekha7	T	C	7: 116,128,685	N980S	probably damaging	Het
Reg4	C	T	3: 98,236,361	T157I	probably benign	Het
Rev3l	G	T	10: 39,824,615	E1703*	probably null	Het
Rev3l	A	T	10: 39,824,616	E1703V	probably damaging	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Saal1	T	C	7: 46,692,916	K368E	probably damaging	Het
Scn9a	C	T	2: 66,504,876	W1245*	probably null	Het
Slc38a11	T	A	2: 65,316,971	L387F	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sptb	C	A	12: 76,620,867	V819L	probably benign	Het
Sptbn1	T	C	11: 30,136,124	T1195A	probably benign	Het
Ssna1	C	A	2: 25,272,012	V57F	possibly damaging	Het
Stk32a	G	T	18: 43,313,420	E312*	probably null	Het
Synpo	A	G	18: 60,603,387	F496L	probably benign	Het
Syt15	C	T	14: 34,222,901	T135M	probably benign	Het
Tm9sf4	A	G	2: 153,190,912	E246G	probably benign	Het
Trim44	T	C	2: 102,357,485	M308V	possibly damaging	Het
Unc119b	T	A	5: 115,134,826	K29*	probably null	Het
Vim	T	A	2: 13,580,110	D367E	probably benign	Het
Virma	T	A	4: 11,494,814	N38K	probably damaging	Het
Vmn1r228	A	T	17: 20,776,298	D319E	possibly damaging	Het
Vmn2r32	T	A	7: 7,463,992	I846F	probably benign	Het
Vps13b	T	C	15: 35,576,521	V1025A	probably benign	Het
Vps13c	G	T	9: 67,972,075	E566*	probably null	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAGACACCAGGCTGCATACTATC -3'
(R):5'- GCCCTCAAAGGAACTGAGTCCAAAG -3'

Sequencing Primer
(F):5'- AGGCACAGTGTTCACCTTAG -3'
(R):5'- CTGAGTCCAAAGGTGACAGC -3'

Posted On

2014-05-14