Incidental Mutation 'R1695:Brca1'
ID 192155
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Name breast cancer 1, early onset
Synonyms
MMRRC Submission 039728-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1695 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 101379590-101442781 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 101415281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 951 (T951K)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
AlphaFold P48754
Predicted Effect probably damaging
Transcript: ENSMUST00000017290
AA Change: T951K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: T951K

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188168
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T A 5: 121,638,970 (GRCm39) T692S probably benign Het
Adgrf3 T A 5: 30,408,553 (GRCm39) N75I probably benign Het
Adgrg5 A G 8: 95,664,373 (GRCm39) M328V probably damaging Het
Adk A G 14: 21,431,668 (GRCm39) D286G probably benign Het
Ankrd28 T A 14: 31,429,201 (GRCm39) D917V probably damaging Het
Appl2 C T 10: 83,457,446 (GRCm39) D141N probably damaging Het
Arfgef2 T C 2: 166,706,632 (GRCm39) V952A probably damaging Het
Arpc2 T A 1: 74,287,391 (GRCm39) H70Q probably damaging Het
Bpifa5 T C 2: 154,009,580 (GRCm39) L261P probably damaging Het
Ccdc73 A T 2: 104,822,450 (GRCm39) S800C probably damaging Het
Cdh15 C G 8: 123,588,755 (GRCm39) D276E probably benign Het
Cfap119 A G 7: 127,186,745 (GRCm39) probably null Het
Cfap418 T A 4: 10,874,644 (GRCm39) D10E probably damaging Het
Cfh T C 1: 140,030,575 (GRCm39) I551V probably damaging Het
Chd7 T A 4: 8,833,960 (GRCm39) L1238Q probably damaging Het
Chd9 T G 8: 91,728,410 (GRCm39) F1275L probably damaging Het
Chrnb3 A G 8: 27,883,728 (GRCm39) Y155C probably damaging Het
Cltc C A 11: 86,591,886 (GRCm39) probably null Het
Ctsll3 T A 13: 60,948,791 (GRCm39) N55Y probably damaging Het
Cysltr2 T C 14: 73,267,321 (GRCm39) M130V probably benign Het
Daglb T C 5: 143,480,361 (GRCm39) M455T probably benign Het
Dbn1 A G 13: 55,624,521 (GRCm39) S343P probably benign Het
Dnah2 T A 11: 69,405,517 (GRCm39) D665V possibly damaging Het
Dusp6 T A 10: 99,099,555 (GRCm39) M1K probably null Het
Eif3m T C 2: 104,847,298 (GRCm39) E12G probably damaging Het
Epha2 T C 4: 141,033,828 (GRCm39) V29A possibly damaging Het
Farp2 T A 1: 93,488,047 (GRCm39) N91K probably damaging Het
Ferd3l C A 12: 33,978,971 (GRCm39) S161R probably benign Het
Fgd2 A T 17: 29,587,219 (GRCm39) D315V possibly damaging Het
Fhip2a T C 19: 57,367,603 (GRCm39) W337R probably damaging Het
Fstl4 T A 11: 53,056,705 (GRCm39) probably null Het
Grm5 A G 7: 87,685,311 (GRCm39) D476G possibly damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Hdlbp A G 1: 93,364,922 (GRCm39) L115P probably damaging Het
Hk2 T A 6: 82,721,932 (GRCm39) N136Y probably damaging Het
Hs2st1 G T 3: 144,140,415 (GRCm39) A302E probably benign Het
Htr7 T C 19: 35,947,136 (GRCm39) N293D probably benign Het
Ikbkb T A 8: 23,163,496 (GRCm39) E271D probably benign Het
Il5ra A T 6: 106,715,335 (GRCm39) Y166* probably null Het
Il9r T A 11: 32,143,227 (GRCm39) H244L probably benign Het
Itih4 T C 14: 30,613,456 (GRCm39) probably null Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Large1 A T 8: 73,544,710 (GRCm39) D689E probably damaging Het
Limk2 A G 11: 3,303,275 (GRCm39) probably null Het
Med15 A G 16: 17,540,644 (GRCm39) F34S probably damaging Het
Mprip C T 11: 59,643,357 (GRCm39) T505I probably damaging Het
Mtor T A 4: 148,623,364 (GRCm39) N2071K probably benign Het
Muc16 A G 9: 18,408,729 (GRCm39) L2522P probably damaging Het
Myd88 A T 9: 119,166,908 (GRCm39) probably null Het
Myo7a A C 7: 97,741,703 (GRCm39) F484V possibly damaging Het
Nme1 A C 11: 93,851,593 (GRCm39) L81R probably benign Het
Ntn4 T A 10: 93,569,464 (GRCm39) probably null Het
Or2y13 T C 11: 49,415,162 (GRCm39) V204A probably benign Het
Or4p19 T C 2: 88,242,444 (GRCm39) D186G probably damaging Het
Or51l4 A T 7: 103,404,131 (GRCm39) Y220* probably null Het
Otogl T G 10: 107,649,878 (GRCm39) N1159T probably damaging Het
Pabpc6 G A 17: 9,887,003 (GRCm39) T516I probably benign Het
Pcdh1 C T 18: 38,335,921 (GRCm39) R238H probably damaging Het
Pex5l T A 3: 33,008,531 (GRCm39) N151I probably benign Het
Plekha7 T C 7: 115,727,920 (GRCm39) N980S probably damaging Het
Reg4 C T 3: 98,143,677 (GRCm39) T157I probably benign Het
Rev3l A T 10: 39,700,612 (GRCm39) E1703V probably damaging Het
Rev3l G T 10: 39,700,611 (GRCm39) E1703* probably null Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Het
Saal1 T C 7: 46,342,340 (GRCm39) K368E probably damaging Het
Scn9a C T 2: 66,335,220 (GRCm39) W1245* probably null Het
Slc38a11 T A 2: 65,147,315 (GRCm39) L387F probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sptb C A 12: 76,667,641 (GRCm39) V819L probably benign Het
Sptbn1 T C 11: 30,086,124 (GRCm39) T1195A probably benign Het
Ssna1 C A 2: 25,162,024 (GRCm39) V57F possibly damaging Het
Stk32a G T 18: 43,446,485 (GRCm39) E312* probably null Het
Synpo A G 18: 60,736,459 (GRCm39) F496L probably benign Het
Syt15 C T 14: 33,944,858 (GRCm39) T135M probably benign Het
Tm9sf4 A G 2: 153,032,832 (GRCm39) E246G probably benign Het
Trim44 T C 2: 102,187,830 (GRCm39) M308V possibly damaging Het
Unc119b T A 5: 115,272,885 (GRCm39) K29* probably null Het
Vim T A 2: 13,584,921 (GRCm39) D367E probably benign Het
Virma T A 4: 11,494,814 (GRCm39) N38K probably damaging Het
Vmn1r228 A T 17: 20,996,560 (GRCm39) D319E possibly damaging Het
Vmn2r32 T A 7: 7,466,991 (GRCm39) I846F probably benign Het
Vps13b T C 15: 35,576,667 (GRCm39) V1025A probably benign Het
Vps13c G T 9: 67,879,357 (GRCm39) E566* probably null Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101,415,195 (GRCm39) missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101,415,156 (GRCm39) missense probably benign 0.04
IGL01744:Brca1 APN 11 101,415,002 (GRCm39) missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101,421,808 (GRCm39) unclassified probably benign
IGL02377:Brca1 APN 11 101,415,149 (GRCm39) missense probably benign 0.01
IGL02701:Brca1 APN 11 101,416,061 (GRCm39) missense probably damaging 1.00
IGL02732:Brca1 APN 11 101,383,045 (GRCm39) missense probably benign 0.07
IGL02935:Brca1 APN 11 101,380,693 (GRCm39) missense probably benign 0.00
IGL02940:Brca1 APN 11 101,380,738 (GRCm39) missense probably benign 0.00
IGL03198:Brca1 APN 11 101,403,537 (GRCm39) splice site probably benign
BB002:Brca1 UTSW 11 101,398,972 (GRCm39) missense probably benign 0.01
BB009:Brca1 UTSW 11 101,430,843 (GRCm39) missense possibly damaging 0.85
BB012:Brca1 UTSW 11 101,398,972 (GRCm39) missense probably benign 0.01
BB019:Brca1 UTSW 11 101,430,843 (GRCm39) missense possibly damaging 0.85
PIT4142001:Brca1 UTSW 11 101,413,248 (GRCm39) unclassified probably benign
R0048:Brca1 UTSW 11 101,415,803 (GRCm39) missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101,415,803 (GRCm39) missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101,421,916 (GRCm39) missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101,421,916 (GRCm39) missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101,416,947 (GRCm39) missense probably damaging 1.00
R0336:Brca1 UTSW 11 101,414,819 (GRCm39) missense probably benign 0.04
R0448:Brca1 UTSW 11 101,399,047 (GRCm39) missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101,415,713 (GRCm39) missense probably benign 0.27
R0613:Brca1 UTSW 11 101,399,036 (GRCm39) missense probably benign 0.18
R0863:Brca1 UTSW 11 101,415,596 (GRCm39) missense probably benign 0.36
R0940:Brca1 UTSW 11 101,422,969 (GRCm39) missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101,416,192 (GRCm39) missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101,392,822 (GRCm39) missense probably benign
R1391:Brca1 UTSW 11 101,417,372 (GRCm39) missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101,421,933 (GRCm39) unclassified probably benign
R1484:Brca1 UTSW 11 101,420,638 (GRCm39) missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101,415,521 (GRCm39) missense probably damaging 1.00
R1645:Brca1 UTSW 11 101,400,879 (GRCm39) missense probably benign 0.00
R1682:Brca1 UTSW 11 101,416,391 (GRCm39) missense probably damaging 0.98
R1687:Brca1 UTSW 11 101,380,666 (GRCm39) missense probably benign
R1694:Brca1 UTSW 11 101,422,925 (GRCm39) missense probably damaging 0.98
R1762:Brca1 UTSW 11 101,422,844 (GRCm39) critical splice donor site probably null
R1868:Brca1 UTSW 11 101,388,839 (GRCm39) missense probably benign
R1973:Brca1 UTSW 11 101,417,229 (GRCm39) missense probably benign 0.22
R2034:Brca1 UTSW 11 101,380,675 (GRCm39) missense probably benign
R2106:Brca1 UTSW 11 101,415,803 (GRCm39) missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101,415,002 (GRCm39) missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101,416,113 (GRCm39) missense probably benign 0.02
R4571:Brca1 UTSW 11 101,408,192 (GRCm39) missense probably benign 0.00
R4735:Brca1 UTSW 11 101,383,001 (GRCm39) splice site probably null
R4789:Brca1 UTSW 11 101,414,758 (GRCm39) missense probably benign 0.00
R4920:Brca1 UTSW 11 101,415,785 (GRCm39) missense probably damaging 1.00
R4939:Brca1 UTSW 11 101,398,876 (GRCm39) missense probably benign
R4997:Brca1 UTSW 11 101,415,159 (GRCm39) missense probably damaging 0.96
R5458:Brca1 UTSW 11 101,408,111 (GRCm39) missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101,416,127 (GRCm39) missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101,415,072 (GRCm39) missense probably damaging 1.00
R6505:Brca1 UTSW 11 101,414,367 (GRCm39) missense probably benign 0.03
R6548:Brca1 UTSW 11 101,415,591 (GRCm39) missense probably damaging 1.00
R6971:Brca1 UTSW 11 101,424,831 (GRCm39) missense probably benign 0.18
R7091:Brca1 UTSW 11 101,417,253 (GRCm39) missense probably benign 0.00
R7246:Brca1 UTSW 11 101,414,204 (GRCm39) missense probably benign 0.00
R7417:Brca1 UTSW 11 101,415,807 (GRCm39) missense probably damaging 1.00
R7861:Brca1 UTSW 11 101,417,248 (GRCm39) missense possibly damaging 0.87
R7925:Brca1 UTSW 11 101,398,972 (GRCm39) missense probably benign 0.01
R7932:Brca1 UTSW 11 101,430,843 (GRCm39) missense possibly damaging 0.85
R8003:Brca1 UTSW 11 101,415,303 (GRCm39) missense probably benign 0.22
R8046:Brca1 UTSW 11 101,416,296 (GRCm39) missense probably benign 0.03
R8306:Brca1 UTSW 11 101,416,463 (GRCm39) missense probably damaging 1.00
R8483:Brca1 UTSW 11 101,416,802 (GRCm39) missense probably damaging 0.99
R8685:Brca1 UTSW 11 101,380,672 (GRCm39) missense probably benign 0.19
R9072:Brca1 UTSW 11 101,393,306 (GRCm39) critical splice donor site probably null
R9073:Brca1 UTSW 11 101,393,306 (GRCm39) critical splice donor site probably null
R9486:Brca1 UTSW 11 101,414,520 (GRCm39) missense probably benign 0.00
R9505:Brca1 UTSW 11 101,403,592 (GRCm39) missense probably benign 0.00
R9616:Brca1 UTSW 11 101,416,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGACACCAGGCTGCATACTATC -3'
(R):5'- GCCCTCAAAGGAACTGAGTCCAAAG -3'

Sequencing Primer
(F):5'- AGGCACAGTGTTCACCTTAG -3'
(R):5'- CTGAGTCCAAAGGTGACAGC -3'
Posted On 2014-05-14