Incidental Mutation 'R1695:Pabpc6'
ID192170
Institutional Source Beutler Lab
Gene Symbol Pabpc6
Ensembl Gene ENSMUSG00000046173
Gene Namepoly(A) binding protein, cytoplasmic 6
Synonyms4932702K14Rik
MMRRC Submission 039728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1695 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location9666497-9669704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9668074 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 516 (T516I)
Ref Sequence ENSEMBL: ENSMUSP00000050792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057190]
Predicted Effect probably benign
Transcript: ENSMUST00000057190
AA Change: T516I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050792
Gene: ENSMUSG00000046173
AA Change: T516I

DomainStartEndE-ValueType
RRM 12 85 1.78e-20 SMART
RRM 100 171 2.54e-25 SMART
RRM 192 264 1.08e-28 SMART
RRM 305 376 7.57e-24 SMART
low complexity region 500 511 N/A INTRINSIC
PolyA 561 624 3.28e-34 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,874,644 D10E probably damaging Het
Adam1b T A 5: 121,500,907 T692S probably benign Het
Adgrf3 T A 5: 30,203,555 N75I probably benign Het
Adgrg5 A G 8: 94,937,745 M328V probably damaging Het
Adk A G 14: 21,381,600 D286G probably benign Het
Ankrd28 T A 14: 31,707,244 D917V probably damaging Het
Appl2 C T 10: 83,621,582 D141N probably damaging Het
Arfgef2 T C 2: 166,864,712 V952A probably damaging Het
Arpc2 T A 1: 74,248,232 H70Q probably damaging Het
Bpifa5 T C 2: 154,167,660 L261P probably damaging Het
Brca1 G T 11: 101,524,455 T951K probably damaging Het
Ccdc189 A G 7: 127,587,573 probably null Het
Ccdc73 A T 2: 104,992,105 S800C probably damaging Het
Cdh15 C G 8: 122,862,016 D276E probably benign Het
Cfh T C 1: 140,102,837 I551V probably damaging Het
Chd7 T A 4: 8,833,960 L1238Q probably damaging Het
Chd9 T G 8: 91,001,782 F1275L probably damaging Het
Chrnb3 A G 8: 27,393,700 Y155C probably damaging Het
Cltc C A 11: 86,701,060 probably null Het
Ctsll3 T A 13: 60,800,977 N55Y probably damaging Het
Cysltr2 T C 14: 73,029,881 M130V probably benign Het
Daglb T C 5: 143,494,606 M455T probably benign Het
Dbn1 A G 13: 55,476,708 S343P probably benign Het
Dnah2 T A 11: 69,514,691 D665V possibly damaging Het
Dusp6 T A 10: 99,263,693 M1K probably null Het
Eif3m T C 2: 105,016,953 E12G probably damaging Het
Epha2 T C 4: 141,306,517 V29A possibly damaging Het
Fam160b1 T C 19: 57,379,171 W337R probably damaging Het
Farp2 T A 1: 93,560,325 N91K probably damaging Het
Ferd3l C A 12: 33,928,972 S161R probably benign Het
Fgd2 A T 17: 29,368,245 D315V possibly damaging Het
Fstl4 T A 11: 53,165,878 probably null Het
Grm5 A G 7: 88,036,103 D476G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdlbp A G 1: 93,437,200 L115P probably damaging Het
Hk2 T A 6: 82,744,951 N136Y probably damaging Het
Hs2st1 G T 3: 144,434,654 A302E probably benign Het
Htr7 T C 19: 35,969,736 N293D probably benign Het
Ikbkb T A 8: 22,673,480 E271D probably benign Het
Il5ra A T 6: 106,738,374 Y166* probably null Het
Il9r T A 11: 32,193,227 H244L probably benign Het
Itih4 T C 14: 30,891,499 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Limk2 A G 11: 3,353,275 probably null Het
Med15 A G 16: 17,722,780 F34S probably damaging Het
Mprip C T 11: 59,752,531 T505I probably damaging Het
Mtor T A 4: 148,538,907 N2071K probably benign Het
Muc16 A G 9: 18,497,433 L2522P probably damaging Het
Myd88 A T 9: 119,337,842 probably null Het
Myo7a A C 7: 98,092,496 F484V possibly damaging Het
Nme1 A C 11: 93,960,767 L81R probably benign Het
Ntn4 T A 10: 93,733,602 probably null Het
Olfr1180 T C 2: 88,412,100 D186G probably damaging Het
Olfr1383 T C 11: 49,524,335 V204A probably benign Het
Olfr630 A T 7: 103,754,924 Y220* probably null Het
Otogl T G 10: 107,814,017 N1159T probably damaging Het
Pcdh1 C T 18: 38,202,868 R238H probably damaging Het
Pex5l T A 3: 32,954,382 N151I probably benign Het
Plekha7 T C 7: 116,128,685 N980S probably damaging Het
Reg4 C T 3: 98,236,361 T157I probably benign Het
Rev3l G T 10: 39,824,615 E1703* probably null Het
Rev3l A T 10: 39,824,616 E1703V probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Saal1 T C 7: 46,692,916 K368E probably damaging Het
Scn9a C T 2: 66,504,876 W1245* probably null Het
Slc38a11 T A 2: 65,316,971 L387F probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sptb C A 12: 76,620,867 V819L probably benign Het
Sptbn1 T C 11: 30,136,124 T1195A probably benign Het
Ssna1 C A 2: 25,272,012 V57F possibly damaging Het
Stk32a G T 18: 43,313,420 E312* probably null Het
Synpo A G 18: 60,603,387 F496L probably benign Het
Syt15 C T 14: 34,222,901 T135M probably benign Het
Tm9sf4 A G 2: 153,190,912 E246G probably benign Het
Trim44 T C 2: 102,357,485 M308V possibly damaging Het
Unc119b T A 5: 115,134,826 K29* probably null Het
Vim T A 2: 13,580,110 D367E probably benign Het
Virma T A 4: 11,494,814 N38K probably damaging Het
Vmn1r228 A T 17: 20,776,298 D319E possibly damaging Het
Vmn2r32 T A 7: 7,463,992 I846F probably benign Het
Vps13b T C 15: 35,576,521 V1025A probably benign Het
Vps13c G T 9: 67,972,075 E566* probably null Het
Other mutations in Pabpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Pabpc6 APN 17 9668498 missense possibly damaging 0.80
IGL00984:Pabpc6 APN 17 9668689 missense probably damaging 1.00
IGL01123:Pabpc6 APN 17 9668147 missense probably benign 0.01
IGL01301:Pabpc6 APN 17 9667970 missense probably benign
IGL02347:Pabpc6 APN 17 9669064 missense probably benign 0.03
ANU18:Pabpc6 UTSW 17 9667970 missense probably benign
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R1593:Pabpc6 UTSW 17 9667813 missense probably damaging 0.98
R3897:Pabpc6 UTSW 17 9669127 missense probably benign 0.38
R3903:Pabpc6 UTSW 17 9669154 missense probably benign 0.16
R4585:Pabpc6 UTSW 17 9669073 missense probably damaging 1.00
R5009:Pabpc6 UTSW 17 9668560 missense probably damaging 1.00
R5112:Pabpc6 UTSW 17 9669611 missense probably damaging 1.00
R5769:Pabpc6 UTSW 17 9667843 nonsense probably null
R6174:Pabpc6 UTSW 17 9668155 missense probably benign
R6488:Pabpc6 UTSW 17 9669599 missense probably damaging 1.00
R7140:Pabpc6 UTSW 17 9668428 missense possibly damaging 0.46
R7586:Pabpc6 UTSW 17 9668682 missense probably damaging 1.00
R8001:Pabpc6 UTSW 17 9669373 missense probably damaging 1.00
R8129:Pabpc6 UTSW 17 9668498 missense possibly damaging 0.80
R8211:Pabpc6 UTSW 17 9669457 missense probably damaging 1.00
R8393:Pabpc6 UTSW 17 9668506 missense probably damaging 1.00
RF038:Pabpc6 UTSW 17 9668115 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCGTGATTTTACCAGCAAGGGCAG -3'
(R):5'- CAGACTACTCAGCAAGGACCAAGTG -3'

Sequencing Primer
(F):5'- CCTGAATAAGAGAGAAGAGCCATTCC -3'
(R):5'- AAGGACCAAGTGCCCGTG -3'
Posted On2014-05-14