Incidental Mutation 'R1695:Vmn1r228'
ID 192171
Institutional Source Beutler Lab
Gene Symbol Vmn1r228
Ensembl Gene ENSMUSG00000060245
Gene Name vomeronasal 1 receptor 228
Synonyms V1re3
MMRRC Submission 039728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1695 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 20996321-20997763 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20996560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 319 (D319E)
Ref Sequence ENSEMBL: ENSMUSP00000072243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072410]
AlphaFold Q8R2A7
Predicted Effect possibly damaging
Transcript: ENSMUST00000072410
AA Change: D319E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072243
Gene: ENSMUSG00000060245
AA Change: D319E

DomainStartEndE-ValueType
Pfam:TAS2R 32 317 2.6e-11 PFAM
Pfam:7tm_1 53 316 2.6e-9 PFAM
Pfam:V1R 63 321 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b T A 5: 121,638,970 (GRCm39) T692S probably benign Het
Adgrf3 T A 5: 30,408,553 (GRCm39) N75I probably benign Het
Adgrg5 A G 8: 95,664,373 (GRCm39) M328V probably damaging Het
Adk A G 14: 21,431,668 (GRCm39) D286G probably benign Het
Ankrd28 T A 14: 31,429,201 (GRCm39) D917V probably damaging Het
Appl2 C T 10: 83,457,446 (GRCm39) D141N probably damaging Het
Arfgef2 T C 2: 166,706,632 (GRCm39) V952A probably damaging Het
Arpc2 T A 1: 74,287,391 (GRCm39) H70Q probably damaging Het
Bpifa5 T C 2: 154,009,580 (GRCm39) L261P probably damaging Het
Brca1 G T 11: 101,415,281 (GRCm39) T951K probably damaging Het
Ccdc73 A T 2: 104,822,450 (GRCm39) S800C probably damaging Het
Cdh15 C G 8: 123,588,755 (GRCm39) D276E probably benign Het
Cfap119 A G 7: 127,186,745 (GRCm39) probably null Het
Cfap418 T A 4: 10,874,644 (GRCm39) D10E probably damaging Het
Cfh T C 1: 140,030,575 (GRCm39) I551V probably damaging Het
Chd7 T A 4: 8,833,960 (GRCm39) L1238Q probably damaging Het
Chd9 T G 8: 91,728,410 (GRCm39) F1275L probably damaging Het
Chrnb3 A G 8: 27,883,728 (GRCm39) Y155C probably damaging Het
Cltc C A 11: 86,591,886 (GRCm39) probably null Het
Ctsll3 T A 13: 60,948,791 (GRCm39) N55Y probably damaging Het
Cysltr2 T C 14: 73,267,321 (GRCm39) M130V probably benign Het
Daglb T C 5: 143,480,361 (GRCm39) M455T probably benign Het
Dbn1 A G 13: 55,624,521 (GRCm39) S343P probably benign Het
Dnah2 T A 11: 69,405,517 (GRCm39) D665V possibly damaging Het
Dusp6 T A 10: 99,099,555 (GRCm39) M1K probably null Het
Eif3m T C 2: 104,847,298 (GRCm39) E12G probably damaging Het
Epha2 T C 4: 141,033,828 (GRCm39) V29A possibly damaging Het
Farp2 T A 1: 93,488,047 (GRCm39) N91K probably damaging Het
Ferd3l C A 12: 33,978,971 (GRCm39) S161R probably benign Het
Fgd2 A T 17: 29,587,219 (GRCm39) D315V possibly damaging Het
Fhip2a T C 19: 57,367,603 (GRCm39) W337R probably damaging Het
Fstl4 T A 11: 53,056,705 (GRCm39) probably null Het
Grm5 A G 7: 87,685,311 (GRCm39) D476G possibly damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Hdlbp A G 1: 93,364,922 (GRCm39) L115P probably damaging Het
Hk2 T A 6: 82,721,932 (GRCm39) N136Y probably damaging Het
Hs2st1 G T 3: 144,140,415 (GRCm39) A302E probably benign Het
Htr7 T C 19: 35,947,136 (GRCm39) N293D probably benign Het
Ikbkb T A 8: 23,163,496 (GRCm39) E271D probably benign Het
Il5ra A T 6: 106,715,335 (GRCm39) Y166* probably null Het
Il9r T A 11: 32,143,227 (GRCm39) H244L probably benign Het
Itih4 T C 14: 30,613,456 (GRCm39) probably null Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Large1 A T 8: 73,544,710 (GRCm39) D689E probably damaging Het
Limk2 A G 11: 3,303,275 (GRCm39) probably null Het
Med15 A G 16: 17,540,644 (GRCm39) F34S probably damaging Het
Mprip C T 11: 59,643,357 (GRCm39) T505I probably damaging Het
Mtor T A 4: 148,623,364 (GRCm39) N2071K probably benign Het
Muc16 A G 9: 18,408,729 (GRCm39) L2522P probably damaging Het
Myd88 A T 9: 119,166,908 (GRCm39) probably null Het
Myo7a A C 7: 97,741,703 (GRCm39) F484V possibly damaging Het
Nme1 A C 11: 93,851,593 (GRCm39) L81R probably benign Het
Ntn4 T A 10: 93,569,464 (GRCm39) probably null Het
Or2y13 T C 11: 49,415,162 (GRCm39) V204A probably benign Het
Or4p19 T C 2: 88,242,444 (GRCm39) D186G probably damaging Het
Or51l4 A T 7: 103,404,131 (GRCm39) Y220* probably null Het
Otogl T G 10: 107,649,878 (GRCm39) N1159T probably damaging Het
Pabpc6 G A 17: 9,887,003 (GRCm39) T516I probably benign Het
Pcdh1 C T 18: 38,335,921 (GRCm39) R238H probably damaging Het
Pex5l T A 3: 33,008,531 (GRCm39) N151I probably benign Het
Plekha7 T C 7: 115,727,920 (GRCm39) N980S probably damaging Het
Reg4 C T 3: 98,143,677 (GRCm39) T157I probably benign Het
Rev3l G T 10: 39,700,611 (GRCm39) E1703* probably null Het
Rev3l A T 10: 39,700,612 (GRCm39) E1703V probably damaging Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Het
Saal1 T C 7: 46,342,340 (GRCm39) K368E probably damaging Het
Scn9a C T 2: 66,335,220 (GRCm39) W1245* probably null Het
Slc38a11 T A 2: 65,147,315 (GRCm39) L387F probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sptb C A 12: 76,667,641 (GRCm39) V819L probably benign Het
Sptbn1 T C 11: 30,086,124 (GRCm39) T1195A probably benign Het
Ssna1 C A 2: 25,162,024 (GRCm39) V57F possibly damaging Het
Stk32a G T 18: 43,446,485 (GRCm39) E312* probably null Het
Synpo A G 18: 60,736,459 (GRCm39) F496L probably benign Het
Syt15 C T 14: 33,944,858 (GRCm39) T135M probably benign Het
Tm9sf4 A G 2: 153,032,832 (GRCm39) E246G probably benign Het
Trim44 T C 2: 102,187,830 (GRCm39) M308V possibly damaging Het
Unc119b T A 5: 115,272,885 (GRCm39) K29* probably null Het
Vim T A 2: 13,584,921 (GRCm39) D367E probably benign Het
Virma T A 4: 11,494,814 (GRCm39) N38K probably damaging Het
Vmn2r32 T A 7: 7,466,991 (GRCm39) I846F probably benign Het
Vps13b T C 15: 35,576,667 (GRCm39) V1025A probably benign Het
Vps13c G T 9: 67,879,357 (GRCm39) E566* probably null Het
Other mutations in Vmn1r228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Vmn1r228 APN 17 20,996,774 (GRCm39) missense probably benign 0.07
IGL03275:Vmn1r228 APN 17 20,997,104 (GRCm39) missense probably damaging 1.00
PIT4498001:Vmn1r228 UTSW 17 20,996,772 (GRCm39) missense probably benign 0.00
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0270:Vmn1r228 UTSW 17 20,996,858 (GRCm39) missense possibly damaging 0.60
R0279:Vmn1r228 UTSW 17 20,996,637 (GRCm39) missense probably benign 0.02
R1544:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R2086:Vmn1r228 UTSW 17 20,997,455 (GRCm39) missense possibly damaging 0.71
R2275:Vmn1r228 UTSW 17 20,996,807 (GRCm39) missense probably damaging 1.00
R2965:Vmn1r228 UTSW 17 20,996,609 (GRCm39) missense probably damaging 0.99
R4425:Vmn1r228 UTSW 17 20,996,861 (GRCm39) missense probably damaging 1.00
R4447:Vmn1r228 UTSW 17 20,997,369 (GRCm39) missense probably damaging 0.96
R5031:Vmn1r228 UTSW 17 20,996,943 (GRCm39) nonsense probably null
R6345:Vmn1r228 UTSW 17 20,997,144 (GRCm39) missense probably damaging 1.00
R7064:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R7880:Vmn1r228 UTSW 17 20,996,672 (GRCm39) missense probably damaging 1.00
R8000:Vmn1r228 UTSW 17 20,997,227 (GRCm39) missense possibly damaging 0.88
R8290:Vmn1r228 UTSW 17 20,996,724 (GRCm39) missense probably benign 0.09
R9022:Vmn1r228 UTSW 17 20,996,778 (GRCm39) missense probably damaging 1.00
R9027:Vmn1r228 UTSW 17 20,997,422 (GRCm39) missense probably benign 0.01
R9291:Vmn1r228 UTSW 17 20,997,023 (GRCm39) missense probably benign
R9492:Vmn1r228 UTSW 17 20,996,862 (GRCm39) missense probably damaging 1.00
R9618:Vmn1r228 UTSW 17 20,997,045 (GRCm39) missense probably benign 0.00
X0018:Vmn1r228 UTSW 17 20,996,963 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCTCACGGTAGGAAGAGAGAACTCA -3'
(R):5'- CAACACAGACCATTCTGGTCCTGG -3'

Sequencing Primer
(F):5'- gcacagtttattgagctaaaaacc -3'
(R):5'- AGACCATTCTGGTCCTGGTTTTC -3'
Posted On 2014-05-14